Regulon of SoxR in Hyphomonas neptunium ATCC 15444

Properties
Regulator type:	Transcription factor
TF locus tag:	HNE_3426
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.2 Sequence: ATCTAAAGTGAACTTGAGAT Locus tag: HNE_3425 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	HNE_3425	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -35 Score: 6.2 Sequence: ATCTCAAGTTCACTTTAGAT Locus tag: HNE_3426 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	HNE_3426	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD