Regulon of SoxR in Oceanicaulis alexandrii HTCC2633

Properties
Regulator type:	Transcription factor
TF locus tag:	OA2633_12050
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Rhodobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.3 Sequence: ATCTCAAGTTAGCTTGAGAA Locus tag: OA2633_12045 Name: null Funciton: hypothetical protein
	OA2633_12045		hypothetical protein
Position: -54 Score: 6.3 Sequence: TTCTCAAGCTAACTTGAGAT Locus tag: OA2633_12050 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	OA2633_12050	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD