Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing OA2633_12045 gene

Properties
Regulog: SoxR - Rhodobacterales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Alpha
Built upon 18 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Oceanicaulis alexandrii HTCC2633
Position: -63
Score: 6.33757
Sequence: ATCTCAAGTTAGCTTGAGAA
Locus tag: OA2633_12045
Name: null
Funciton: hypothetical protein
OA2633_12045 -63 6.3 ATCTCAAGTTAGCTTGAGAA OA2633_12045