Regulog SoxR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | 6 | 3 |
| Acidovorax sp. JS42 | ||
| Comamonas testosteroni KF-1 | 3 | 2 |
| Delftia acidovorans SPH-1 | 4 | 3 |
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | 2 | 2 |
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | 2 | 2 |
| Verminephrobacter eiseniae EF01-2 | ||
| Methylibium petroleiphilum PM1 | ||
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| soxR |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -61 score = 6.67963 sequence = ACCTCAACTAAACTTGAGGT Gene: Aave_2276: Redox-sensitive transcriptional activator, MerR family |
|
*
Comamonas testosteroni KF-1 Site: position = -32 score = 6.53382 sequence = ACCTCAACTAAGCTTGAGGT Gene: CtesDRAFT_3229: Redox-sensitive transcriptional activator, MerR family |
*
Delftia acidovorans SPH-1 Site: position = -72 score = 6.53153 sequence = ACCTCAACCAAAGTTGAGGT Gene: Daci_1189: Redox-sensitive transcriptional activator, MerR family |
|
*
Polaromonas sp. JS666 Site: position = -33 score = 6.67963 sequence = ACCTCAAGTAAAGTTGAGGT Gene: Bpro_1373: Redox-sensitive transcriptional activator, MerR family |
|
*
Variovorax paradoxus S110 Site: position = -32 score = 6.3023 sequence = ACCTCAACTAAAGTCGAGGT Gene: Vapar_4431: Redox-sensitive transcriptional activator, MerR family |
|
|
|
Redox-sensitive transcriptional activator, MerR family |
| CRON 2. | ||||||||||||
| PF01042 |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -85 score = 6.67963 sequence = ACCTCAAGTTTAGTTGAGGT Gene: Aave_2275: Endoribonuclease L-PSP |
|
*
Comamonas testosteroni KF-1 Site: position = -99 score = 6.53382 sequence = ACCTCAAGCTTAGTTGAGGT Gene: CtesDRAFT_3230: Endoribonuclease L-PSP |
*
Delftia acidovorans SPH-1 Site: position = -77 score = 6.53153 sequence = ACCTCAACTTTGGTTGAGGT Gene: Daci_1188: Endoribonuclease L-PSP |
|
|
|
|
|
|
|
Endoribonuclease L-PSP |
| PF07690 |
Gene: Aave_2274: Permease of the major facilitator superfamily |
|
Gene: CtesDRAFT_3231: Permease of the major facilitator superfamily |
Gene: Daci_1187: Permease of the major facilitator superfamily |
|
|
|
|
|
|
|
Permease of the major facilitator superfamily |
| CRON 3. | ||||||||||||
| PF03992 |
|
|
|
|
|
*
Polaromonas sp. JS666 Site: position = -83 score = 6.67963 sequence = ACCTCAACTTTACTTGAGGT Gene: Bpro_1374: Monooxygenase |
|
|
|
|
|
Monooxygenase |
| CRON 4. | ||||||||||||
| Vapar_4430 |
|
|
|
|
|
|
|
*
Variovorax paradoxus S110 Site: position = -35 score = 6.20869 sequence = ACCTCAAGTTAGGTTGAGGC Gene: Vapar_4430: hypothetical protein |
|
|
|
hypothetical protein |
| CRON 5. | ||||||||||||
| mexE |
*
Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -185 score = 5.93405 sequence = ACCTCAACAATGGTTGAGGT Gene: Aave_1362: RND transporter, membrane fusion protein |
|
Gene: CtesDRAFT_2010: RND transporter, membrane fusion protein |
Gene: Daci_5137: RND transporter, membrane fusion protein |
2
Polaromonas naphthalenivorans CJ2 Gene: Pnap_1297: RND transporter, membrane fusion protein Gene: Pnap_1298: RND transporter, membrane fusion protein |
Gene: Bpro_3429: RND transporter, membrane fusion protein |
|
Gene: Vapar_2562: RND transporter, membrane fusion protein |
|
Gene: Mpe_A0869: RND transporter, membrane fusion protein |
|
RND transporter, membrane fusion protein |
| mexF |
Gene: Aave_1363: RND transporter, membrane fusion protein |
|
Gene: CtesDRAFT_2009: RND transporter, membrane fusion protein |
Gene: Daci_5136: RND transporter, membrane fusion protein |
Gene: Pnap_1299: RND transporter, membrane fusion protein |
Gene: Bpro_3428: RND transporter, membrane fusion protein |
|
Gene: Vapar_2563: RND transporter, membrane fusion protein |
|
Gene: Mpe_A0868: RND transporter, membrane fusion protein |
|
RND transporter, membrane fusion protein |
| oprN |
Gene: Aave_1364: RND transporter, outer membrane protein |
|
Gene: CtesDRAFT_2008: RND transporter, outer membrane protein |
Gene: Daci_5135: RND transporter, outer membrane protein |
Gene: Pnap_1300: RND transporter, outer membrane protein |
Gene: Bpro_3427: RND transporter, outer membrane protein |
|
Gene: Vapar_2564: RND transporter, outer membrane protein |
|
Gene: Mpe_A0867: RND transporter, outer membrane protein |
|
RND transporter, outer membrane protein |
| CRON 6. | ||||||||||||
| PF07690 |
|
|
|
*
Delftia acidovorans SPH-1 Site: position = -45 score = 5.61912 sequence = ATCTCAACCGCACTTGAGGT Gene: Daci_3895: Permease of the major facilitator superfamily |
|
|
|
|
|
|
|
Permease of the major facilitator superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |