Regulog SoxR - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/Beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1	6	3
Acidovorax sp. JS42
Comamonas testosteroni KF-1	3	2
Delftia acidovorans SPH-1	4	3
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666	2	2
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110	2	2
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
soxR	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -61 score = 6.67963 sequence = ACCTCAACTAAACTTGAGGT Gene: Aave_2276: Redox-sensitive transcriptional activator, MerR family	Acidovorax sp. JS42	* Comamonas testosteroni KF-1 Site: position = -32 score = 6.53382 sequence = ACCTCAACTAAGCTTGAGGT Gene: CtesDRAFT_3229: Redox-sensitive transcriptional activator, MerR family	* Delftia acidovorans SPH-1 Site: position = -72 score = 6.53153 sequence = ACCTCAACCAAAGTTGAGGT Gene: Daci_1189: Redox-sensitive transcriptional activator, MerR family	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -33 score = 6.67963 sequence = ACCTCAAGTAAAGTTGAGGT Gene: Bpro_1373: Redox-sensitive transcriptional activator, MerR family	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -32 score = 6.3023 sequence = ACCTCAACTAAAGTCGAGGT Gene: Vapar_4431: Redox-sensitive transcriptional activator, MerR family	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Redox-sensitive transcriptional activator, MerR family

CRON 2.
PF01042	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -85 score = 6.67963 sequence = ACCTCAAGTTTAGTTGAGGT Gene: Aave_2275: Endoribonuclease L-PSP	Acidovorax sp. JS42	* Comamonas testosteroni KF-1 Site: position = -99 score = 6.53382 sequence = ACCTCAAGCTTAGTTGAGGT Gene: CtesDRAFT_3230: Endoribonuclease L-PSP	* Delftia acidovorans SPH-1 Site: position = -77 score = 6.53153 sequence = ACCTCAACTTTGGTTGAGGT Gene: Daci_1188: Endoribonuclease L-PSP	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Endoribonuclease L-PSP
PF07690	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_2274: Permease of the major facilitator superfamily	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_3231: Permease of the major facilitator superfamily	Delftia acidovorans SPH-1 Gene: Daci_1187: Permease of the major facilitator superfamily	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Permease of the major facilitator superfamily

CRON 3.
PF03992	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	* Polaromonas sp. JS666 Site: position = -83 score = 6.67963 sequence = ACCTCAACTTTACTTGAGGT Gene: Bpro_1374: Monooxygenase	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Monooxygenase

CRON 4.
Vapar_4430	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	* Variovorax paradoxus S110 Site: position = -35 score = 6.20869 sequence = ACCTCAAGTTAGGTTGAGGC Gene: Vapar_4430: hypothetical protein	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	hypothetical protein

CRON 5.
mexE	* Acidovorax avenae subsp. citrulli AAC00-1 Site: position = -185 score = 5.93405 sequence = ACCTCAACAATGGTTGAGGT Gene: Aave_1362: RND transporter, membrane fusion protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_2010: RND transporter, membrane fusion protein	Delftia acidovorans SPH-1 Gene: Daci_5137: RND transporter, membrane fusion protein	2 Polaromonas naphthalenivorans CJ2 Gene: Pnap_1297: RND transporter, membrane fusion protein Gene: Pnap_1298: RND transporter, membrane fusion protein	Polaromonas sp. JS666 Gene: Bpro_3429: RND transporter, membrane fusion protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_2562: RND transporter, membrane fusion protein	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A0869: RND transporter, membrane fusion protein	Leptothrix cholodnii SP-6	RND transporter, membrane fusion protein
mexF	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_1363: RND transporter, membrane fusion protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_2009: RND transporter, membrane fusion protein	Delftia acidovorans SPH-1 Gene: Daci_5136: RND transporter, membrane fusion protein	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1299: RND transporter, membrane fusion protein	Polaromonas sp. JS666 Gene: Bpro_3428: RND transporter, membrane fusion protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_2563: RND transporter, membrane fusion protein	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A0868: RND transporter, membrane fusion protein	Leptothrix cholodnii SP-6	RND transporter, membrane fusion protein
oprN	Acidovorax avenae subsp. citrulli AAC00-1 Gene: Aave_1364: RND transporter, outer membrane protein	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_2008: RND transporter, outer membrane protein	Delftia acidovorans SPH-1 Gene: Daci_5135: RND transporter, outer membrane protein	Polaromonas naphthalenivorans CJ2 Gene: Pnap_1300: RND transporter, outer membrane protein	Polaromonas sp. JS666 Gene: Bpro_3427: RND transporter, outer membrane protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110 Gene: Vapar_2564: RND transporter, outer membrane protein	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A0867: RND transporter, outer membrane protein	Leptothrix cholodnii SP-6	RND transporter, outer membrane protein

CRON 6.
PF07690	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1	* Delftia acidovorans SPH-1 Site: position = -45 score = 5.61912 sequence = ATCTCAACCGCACTTGAGGT Gene: Daci_3895: Permease of the major facilitator superfamily	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Permease of the major facilitator superfamily

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SoxR - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --