Regulon of SoxR in Comamonas testosteroni KF-1

Properties
Regulator type:	Transcription factor
TF locus tag:	CtesDRAFT_3229
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -99 Score: 6.5 Sequence: ACCTCAAGCTTAGTTGAGGT Locus tag: CtesDRAFT_3230 Name: PF01042 Funciton: Endoribonuclease L-PSP Locus tag: CtesDRAFT_3231 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	CtesDRAFT_3230	PF01042	Endoribonuclease L-PSP
	CtesDRAFT_3231	PF07690	Permease of the major facilitator superfamily
Position: -32 Score: 6.5 Sequence: ACCTCAACTAAGCTTGAGGT Locus tag: CtesDRAFT_3229 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	CtesDRAFT_3229	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD