Regulon of SoxR in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aave_2276
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -185 Score: 5.9 Sequence: ACCTCAACAATGGTTGAGGT Locus tag: Aave_1362 Name: mexE Funciton: RND transporter, membrane fusion protein Locus tag: Aave_1363 Name: mexF Funciton: RND transporter, membrane fusion protein Locus tag: Aave_1364 Name: oprN Funciton: RND transporter, outer membrane protein
	Aave_1362	mexE	RND transporter, membrane fusion protein
	Aave_1363	mexF	RND transporter, membrane fusion protein
	Aave_1364	oprN	RND transporter, outer membrane protein
Position: -61 Score: 6.7 Sequence: ACCTCAACTAAACTTGAGGT Locus tag: Aave_2276 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Aave_2276	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -85 Score: 6.7 Sequence: ACCTCAAGTTTAGTTGAGGT Locus tag: Aave_2275 Name: PF01042 Funciton: Endoribonuclease L-PSP Locus tag: Aave_2274 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	Aave_2275	PF01042	Endoribonuclease L-PSP
	Aave_2274	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD