Regulon of SoxR in Variovorax paradoxus S110

Properties
Regulator type:	Transcription factor
TF locus tag:	Vapar_4431
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 6.3 Sequence: ACCTCAACTAAAGTCGAGGT Locus tag: Vapar_4431 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Vapar_4431	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -35 Score: 6.2 Sequence: ACCTCAAGTTAGGTTGAGGC Locus tag: Vapar_4430 Name: null Funciton: hypothetical protein
	Vapar_4430		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD