Regulon of SoxR in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_1189
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Comamonadaceae
Statistics of regulated genes:
- Genes	4
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 5.6 Sequence: ATCTCAACCGCACTTGAGGT Locus tag: Daci_3895 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	Daci_3895	PF07690	Permease of the major facilitator superfamily
Position: -77 Score: 6.5 Sequence: ACCTCAACTTTGGTTGAGGT Locus tag: Daci_1188 Name: PF01042 Funciton: Endoribonuclease L-PSP Locus tag: Daci_1187 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	Daci_1188	PF01042	Endoribonuclease L-PSP
	Daci_1187	PF07690	Permease of the major facilitator superfamily
Position: -72 Score: 6.5 Sequence: ACCTCAACCAAAGTTGAGGT Locus tag: Daci_1189 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Daci_1189	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD