Regulog SoxR - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia pseudomallei K96243 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia sp. 383 | 6 | 3 |
| Burkholderia cepacia AMMD | 3 | 3 |
| Burkholderia vietnamiensis G4 | ||
| Burkholderia glumae BGR1 | 2 | 2 |
| Burkholderia xenovorans LB400 | ||
| Burkholderia phymatum STM815 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| soxR |
|
|
*
Burkholderia sp. 383 Site: position = -42 score = 6.7046 sequence = AGTTGAAGTTAACTTCAAGT Gene: Bcep18194_B1003: Redox-sensitive transcriptional activator, MerR family |
*
Burkholderia cepacia AMMD Site: position = -40 score = 6.7046 sequence = AGTTGAAGTTAACTTCAAGT Gene: Bamb_4130: Redox-sensitive transcriptional activator, MerR family |
|
*
Burkholderia glumae BGR1 Site: position = -43 score = 6.13044 sequence = GGTTCAAGTAAACTTGAGGT Gene: bglu_1g22620: Redox-sensitive transcriptional activator, MerR family |
|
|
Redox-sensitive transcriptional activator, MerR family |
| CRON 2. | |||||||||
| cmeA |
|
|
*
Burkholderia sp. 383 Site: position = -58 score = 6.7046 sequence = ACTTGAAGTTAACTTCAACT Gene: Bcep18194_B1004: RND transporter, membrane fusion protein |
|
|
|
|
|
RND transporter, membrane fusion protein |
| cmeB |
|
|
Gene: Bcep18194_B1005: RND transporter, inner membrane protein |
|
|
|
|
|
RND transporter, inner membrane protein |
| cmeC |
|
|
Gene: Bcep18194_B1006: RND transporter, outer membrane protein |
|
|
|
|
|
RND transporter, outer membrane protein |
| CRON 3. | |||||||||
| Bamb_4129 |
|
|
|
*
Burkholderia cepacia AMMD Site: position = -58 score = 6.7046 sequence = ACTTGAAGTTAACTTCAACT Gene: Bamb_4129: hypothetical protein |
|
|
|
|
hypothetical protein |
| CRON 4. | |||||||||
| PF07690 |
|
|
*
Burkholderia sp. 383 Site: position = -65 score = 6.28613 sequence = ACTTGAAGTTAACTTCAATT Gene: Bcep18194_B1327: Permease of the major facilitator superfamily |
|
|
|
|
|
Permease of the major facilitator superfamily |
| PF11811 |
|
|
Gene: Bcep18194_B1328: Protein of unknown function DUF3331 |
*
Burkholderia cepacia AMMD Site: position = -91 score = 6.28613 sequence = ACTTGAAGTTAACTTCAATT Gene: Bamb_3952: Protein of unknown function DUF3331 |
|
|
|
|
Protein of unknown function DUF3331 |
| CRON 5. | |||||||||
| bglu_1g22630 |
|
|
|
|
|
*
Burkholderia glumae BGR1 Site: position = -61 score = 6.13044 sequence = ACCTCAAGTTTACTTGAACC Gene: bglu_1g22630: hypothetical protein |
|
|
hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |