Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing PF11811 gene

Properties
Regulog: SoxR - Burkholderia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia cepacia AMMD
Position: -91
Score: 6.28613
Sequence: ACTTGAAGTTAACTTCAATT
Locus tag: Bamb_3952
Name: PF11811
Funciton: Protein of unknown function DUF3331
PF11811 -91 6.3 ACTTGAAGTTAACTTCAATT Bamb_3952
Burkholderia sp. 383
Position: -65
Score: 6.28613
Sequence: ACTTGAAGTTAACTTCAATT
Locus tag: Bcep18194_B1327
Name: PF07690
Funciton: Permease of the major facilitator superfamily
Locus tag: Bcep18194_B1328
Name: PF11811
Funciton: Protein of unknown function DUF3331
PF07690-PF11811 -65 6.3 ACTTGAAGTTAACTTCAATT Bcep18194_B1327