Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bglu_1g22630 gene

Properties
Regulog: SoxR - Burkholderia
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Beta
Built upon 8 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia glumae BGR1
Position: -61
Score: 6.13044
Sequence: ACCTCAAGTTTACTTGAACC
Locus tag: bglu_1g22630
Name: null
Funciton: hypothetical protein
bglu_1g22630 -61 6.1 ACCTCAAGTTTACTTGAACC bglu_1g22630
© 2009-2020 RegPrecise