Regulon of SoxR in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g22620
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Burkholderia
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.1 Sequence: GGTTCAAGTAAACTTGAGGT Locus tag: bglu_1g22620 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	bglu_1g22620	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -61 Score: 6.1 Sequence: ACCTCAAGTTTACTTGAACC Locus tag: bglu_1g22630 Name: null Funciton: hypothetical protein
	bglu_1g22630		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD