Regulon of SoxR in Burkholderia cepacia AMMD

Properties
Regulator type:	Transcription factor
TF locus tag:	Bamb_4130
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6.7 Sequence: AGTTGAAGTTAACTTCAAGT Locus tag: Bamb_4130 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Bamb_4130	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -58 Score: 6.7 Sequence: ACTTGAAGTTAACTTCAACT Locus tag: Bamb_4129 Name: null Funciton: hypothetical protein
	Bamb_4129		hypothetical protein
Position: -91 Score: 6.3 Sequence: ACTTGAAGTTAACTTCAATT Locus tag: Bamb_3952 Name: PF11811 Funciton: Protein of unknown function DUF3331
	Bamb_3952	PF11811	Protein of unknown function DUF3331

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD