Regulon of SoxR in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_B1003
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Burkholderia
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.7 Sequence: AGTTGAAGTTAACTTCAAGT Locus tag: Bcep18194_B1003 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Bcep18194_B1003	soxR	Redox-sensitive transcriptional activator, MerR family
Position: -58 Score: 6.7 Sequence: ACTTGAAGTTAACTTCAACT Locus tag: Bcep18194_B1004 Name: cmeA Funciton: RND transporter, membrane fusion protein Locus tag: Bcep18194_B1005 Name: cmeB Funciton: RND transporter, inner membrane protein Locus tag: Bcep18194_B1006 Name: cmeC Funciton: RND transporter, outer membrane protein
	Bcep18194_B1004	cmeA	RND transporter, membrane fusion protein
	Bcep18194_B1005	cmeB	RND transporter, inner membrane protein
	Bcep18194_B1006	cmeC	RND transporter, outer membrane protein
Position: -65 Score: 6.3 Sequence: ACTTGAAGTTAACTTCAATT Locus tag: Bcep18194_B1327 Name: PF07690 Funciton: Permease of the major facilitator superfamily Locus tag: Bcep18194_B1328 Name: PF11811 Funciton: Protein of unknown function DUF3331
	Bcep18194_B1327	PF07690	Permease of the major facilitator superfamily
	Bcep18194_B1328	PF11811	Protein of unknown function DUF3331

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD