Regulog RhiR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Rhamnogalacturonides utilization |
| Effector: | Rhamogalacturonate oligosaccharides |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Rhamogalacturonate oligosaccharides
- By pathway - Rhamnogalacturonides utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 7 | 2 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 7 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 7 | 2 |
| Rhizobium sp. NGR234 | 7 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| rhiX |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -183 score = 6.22034 sequence = CAATGAAAACATTTTCACAA Site: position = -43 score = 6.24835 sequence = TCGTGAAAATAATTTCATTA Gene: Atu4562: hypothetical protein |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -214 score = 6.19535 sequence = CCATGAAAACATTTTCATCA Site: position = -73 score = 5.93598 sequence = GAATGAAAAGATTTTCATGC Gene: RHE_PF00296: hypothetical protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -180 score = 6.45561 sequence = CCATGAAAACATTTTCATTA Site: position = -40 score = 6.53264 sequence = TAATGAAAATATTTTCATAG Gene: pRL120686: hypothetical protein |
*
Rhizobium sp. NGR234 Site: position = -182 score = 5.90161 sequence = TCATGAAAACTTTTTCATAA Site: position = -39 score = 5.99589 sequence = TGATGAAAACATTTTCATAC Gene: NGR_b17680: hypothetical protein |
|
|
|
hypothetical protein |
| rhiN |
Gene: Atu4561: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
|
|
|
|
|
|
|
|
Gene: RHE_PF00295: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
Gene: pRL120687: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
Gene: NGR_b17690: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
|
|
|
Rhamnogalacturonyl hydrolase (EC 3.2.1.172) |
| pgl |
Gene: Atu4560: Polygalacturonase (EC 3.2.1.15) |
|
|
|
|
|
|
|
|
Gene: RHE_PF00294: Polygalacturonase (EC 3.2.1.15) |
Gene: pRL120688: Polygalacturonase (EC 3.2.1.15) |
Gene: NGR_b17700: Polygalacturonase (EC 3.2.1.15) |
|
|
|
Polygalacturonase (EC 3.2.1.15) |
| rhiK |
Gene: Atu4559: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
Gene: RHE_PF00293: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
Gene: pRL120689: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
Gene: NGR_b17710: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
|
|
|
Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein |
| rhiG |
Gene: Atu4558: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
|
|
|
|
|
|
|
|
Gene: RHE_PF00292: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
Gene: pRL120690: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
Gene: NGR_b17720: Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 2 |
| rhiF |
Gene: Atu4557: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
|
|
|
|
|
|
|
|
Gene: RHE_PF00291: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
Gene: pRL120691: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
Gene: NGR_b17730: Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
|
|
|
Putatuve rhamnogalacturonides ABC transporter, permease component 1 |
| CRON 2. | ||||||||||||||||
| rhiL |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -171 score = 6.24835 sequence = TAATGAAATTATTTTCACGA Site: position = -31 score = 6.22034 sequence = TTGTGAAAATGTTTTCATTG Gene: Atu4564: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -171 score = 5.93598 sequence = GCATGAAAATCTTTTCATTC Site: position = -30 score = 6.19535 sequence = TGATGAAAATGTTTTCATGG Gene: RHE_PF00297: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -164 score = 6.53264 sequence = CTATGAAAATATTTTCATTA Site: position = -24 score = 6.45561 sequence = TAATGAAAATGTTTTCATGG Gene: pRL120685: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -175 score = 5.99589 sequence = GTATGAAAATGTTTTCATCA Site: position = -32 score = 5.90161 sequence = TTATGAAAAAGTTTTCATGA Gene: NGR_b17670: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
|
|
|
Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |