Regulon of RhiR in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu4556
Regulator family:	LacI
Regulation mode:
Biological process:	Rhamnogalacturonides utilization
Effector:	Rhamogalacturonate oligosaccharides
Regulog:	RhiR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Rhamogalacturonate oligosaccharides
By pathway - Rhamnogalacturonides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -171 Score: 6.2 Sequence: TAATGAAATTATTTTCACGA Position: -31 Score: 6.2 Sequence: TTGTGAAAATGTTTTCATTG Locus tag: Atu4564 Name: rhiL Funciton: Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
	Atu4564	rhiL	Putatuve rhamnogalacturonides ABC transporter, substrate-binding protein
Position: -183 Score: 6.2 Sequence: CAATGAAAACATTTTCACAA Position: -43 Score: 6.2 Sequence: TCGTGAAAATAATTTCATTA Locus tag: Atu4562 Name: rhiX Funciton: hypothetical protein Locus tag: Atu4561 Name: rhiN Funciton: Rhamnogalacturonyl hydrolase (EC 3.2.1.172) Locus tag: Atu4560 Name: pgl Funciton: Polygalacturonase (EC 3.2.1.15) Locus tag: Atu4559 Name: rhiK Funciton: Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein Locus tag: Atu4558 Name: rhiG Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 2 Locus tag: Atu4557 Name: rhiF Funciton: Putatuve rhamnogalacturonides ABC transporter, permease component 1
	Atu4562	rhiX	hypothetical protein
	Atu4561	rhiN	Rhamnogalacturonyl hydrolase (EC 3.2.1.172)
	Atu4560	pgl	Polygalacturonase (EC 3.2.1.15)
	Atu4559	rhiK	Putatuve rhamnogalacturonides ABC transporter, ATP-binding protein
	Atu4558	rhiG	Putatuve rhamnogalacturonides ABC transporter, permease component 2
	Atu4557	rhiF	Putatuve rhamnogalacturonides ABC transporter, permease component 1

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD