Regulog HrcA - Desulfuromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Statistics of regulated genes
Genome	Genes	Operons
Geobacter metallireducens GS-15	7	3
Geobacter sulfurreducens PCA	7	3
Geobacter uraniumreducens Rf4	7	3
Geobacter sp. FRC-32	7	3
Geobacter sp. M21	7	3
Geobacter lovleyi SZ	8	4
Pelobacter propionicus DSM 2379	8	4
Pelobacter carbinolicus str. DSM 2380	7	3
Desulfuromonas acetoxidans DSM 684	7	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
groS	* Geobacter metallireducens GS-15 Site: position = -81 score = 7.44104 sequence = TTAGCACTCAGCTGTATCGAGTGCTAA Gene: Gmet_0028: Heat shock protein 60 family co-chaperone GroES	* Geobacter sulfurreducens PCA Site: position = -80 score = 7.40729 sequence = TTAGCACTCAGTCGTATCGAGTGCTAA Gene: GSU3339: Heat shock protein 60 family co-chaperone GroES	* Geobacter uraniumreducens Rf4 Site: position = -85 score = 7.16517 sequence = TTAGCACTCGGCAGCTTGGAGTGCTAA Gene: Gura_4306: Heat shock protein 60 family co-chaperone GroES	* Geobacter sp. FRC-32 Site: position = -81 score = 7.04923 sequence = TTAGCACTCAGCTACAAGGAGTGCTAA Gene: Geob_0399: Heat shock protein 60 family co-chaperone GroES	* Geobacter sp. M21 Site: position = -78 score = 7.56178 sequence = TTAGCACTCAGCAGTTTTGAGTGCTAA Gene: GM21_0232: Heat shock protein 60 family co-chaperone GroES	* Geobacter lovleyi SZ Site: position = -79 score = 6.88277 sequence = TTAGCACTCACCGCTTTAGAGTGCTAG Gene: Glov_2928: Heat shock protein 60 family co-chaperone GroES	* Pelobacter propionicus DSM 2379 Site: position = -77 score = 7.29604 sequence = TTAGCACTCGGTCATCGTGAGTGCTAA Gene: Ppro_2803: Heat shock protein 60 family co-chaperone GroES	* Pelobacter carbinolicus str. DSM 2380 Site: position = -159 score = 7.24253 sequence = TTAGCACTCATGTAAACCGAGTGCTAA Gene: Pcar_2771: Heat shock protein 60 family co-chaperone GroES	* Desulfuromonas acetoxidans DSM 684 Site: position = -105 score = 7.19551 sequence = TTAGCACTCCCTTTTGCTGAGTGCTAA Gene: Dace_1149: Heat shock protein 60 family co-chaperone GroES	Heat shock protein 60 family co-chaperone GroES
groL	Geobacter metallireducens GS-15 Gene: Gmet_0029: Heat shock protein 60 family chaperone GroEL	Geobacter sulfurreducens PCA Gene: GSU3340: Heat shock protein 60 family chaperone GroEL	Geobacter uraniumreducens Rf4 Gene: Gura_4307: Heat shock protein 60 family chaperone GroEL	Geobacter sp. FRC-32 Gene: Geob_0398: Heat shock protein 60 family chaperone GroEL	Geobacter sp. M21 Gene: GM21_0233: Heat shock protein 60 family chaperone GroEL	Geobacter lovleyi SZ Gene: Glov_2929: Heat shock protein 60 family chaperone GroEL	Pelobacter propionicus DSM 2379 Gene: Ppro_2802: Heat shock protein 60 family chaperone GroEL	Pelobacter carbinolicus str. DSM 2380 Gene: Pcar_2770: Heat shock protein 60 family chaperone GroEL	Desulfuromonas acetoxidans DSM 684 Gene: Dace_1148: Heat shock protein 60 family chaperone GroEL	Heat shock protein 60 family chaperone GroEL

CRON 2.
rpoH	* Geobacter metallireducens GS-15 Site: position = -64 score = 7.31418 sequence = TTAGCACTCAGACAAACCGAGTGCTAA Gene: Gmet_2854: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	* Geobacter sulfurreducens PCA Site: position = -52 score = 7.37108 sequence = TTAGCACTCAGACGTACCGAGTGCTAA Gene: GSU0655: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	* Geobacter uraniumreducens Rf4 Site: position = -92 score = 6.79031 sequence = TTAGCACTCTTAACTTGAGAGTGCCAA Gene: Gura_3950: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	* Geobacter sp. FRC-32 Site: position = -58 score = 7.23303 sequence = TTAGCACTCGATTCTGAAGAGTGCTAA Gene: Geob_0795: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	* Geobacter sp. M21 Site: position = -69 score = 6.79368 sequence = TTAGCGCTCACATGGGCAGAGTGCTAA Gene: GM21_0586: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	2 Geobacter lovleyi SZ* Site: position = -56 score = 7.05012 sequence = TTAGCAGTCAGCACCATAGAGTGCTAA Gene: Glov_0181: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) Site: position = -51 score = 6.88374 sequence = TTAGCAGTCTTGTGTGTCGAGTGCTAA Gene: Glov_1330: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	2 Pelobacter propionicus DSM 2379* Site: position = -56 score = 6.88181 sequence = TTAGCAGTCACCGCACGAGAGTGCTAA Gene: Ppro_0114: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) Site: position = -63 score = 6.5616 sequence = TTGGCAGTCGGACGGCTTGAGTGCTAA Gene: Ppro_0664: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	* Pelobacter carbinolicus str. DSM 2380 Site: position = -59 score = 7.12024 sequence = TTAGCACTCGCCATCAACGAGTGCTAA Gene: Pcar_2382: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	* Desulfuromonas acetoxidans DSM 684 Site: position = -63 score = 7.30491 sequence = TTAGCACTCAAGGCAAGAGAGTGCTAA Gene: Dace_1569: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

CRON 3.
hrcA	* Geobacter metallireducens GS-15 Site: position = -46 score = 7.39077 sequence = TTAGCACTCACCAACTCTGAGTGCTAA Gene: Gmet_3534: Heat shock response transcriptional regulator HrcA, HrcA family	* Geobacter sulfurreducens PCA Site: position = -48 score = 7.3888 sequence = TTAGCACTCACGTCCCTTGAGTGCTAA Gene: GSU0031: Heat shock response transcriptional regulator HrcA, HrcA family	* Geobacter uraniumreducens Rf4 Site: position = -47 score = 7.38005 sequence = TTAGCACTCGAATTCCTTGAGTGCTAA Gene: Gura_0209: Heat shock response transcriptional regulator HrcA, HrcA family	* Geobacter sp. FRC-32 Site: position = -49 score = 7.48133 sequence = TTAGCACTCAAATTCTTTGAGTGCTAA Gene: Geob_1105: Heat shock response transcriptional regulator HrcA, HrcA family	* Geobacter sp. M21 Site: position = -47 score = 7.42478 sequence = TTAGCACTCGAACTTTTTGAGTGCTAA Gene: GM21_3576: Heat shock response transcriptional regulator HrcA, HrcA family	* Geobacter lovleyi SZ Site: position = -79 score = 7.43848 sequence = TTAGCACTCAAGTTTATAGAGTGCTAA Gene: Glov_2831: Heat shock response transcriptional regulator HrcA, HrcA family	* Pelobacter propionicus DSM 2379 Site: position = -44 score = 6.80092 sequence = TTAGCACTCTCCAGTCATGAGTGCTAT Gene: Ppro_1406: Heat shock response transcriptional regulator HrcA, HrcA family	* Pelobacter carbinolicus str. DSM 2380 Site: position = -42 score = 7.38601 sequence = TTAGCACTCAATAAGCTAGAGTGCTAA Gene: Pcar_0109: Heat shock response transcriptional regulator HrcA, HrcA family	* Desulfuromonas acetoxidans DSM 684 Site: position = -86 score = 7.21685 sequence = TTAGCACTCCGGATGTTTGAGTGCTAA Gene: Dace_0267: Heat shock response transcriptional regulator HrcA, HrcA family	Heat shock response transcriptional regulator HrcA, HrcA family
grpE	Geobacter metallireducens GS-15 Gene: Gmet_3533: Heat shock protein GrpE	Geobacter sulfurreducens PCA Gene: GSU0032: Heat shock protein GrpE	Geobacter uraniumreducens Rf4 Gene: Gura_0210: Heat shock protein GrpE	Geobacter sp. FRC-32 Gene: Geob_1106: Heat shock protein GrpE	Geobacter sp. M21 Gene: GM21_3575: Heat shock protein GrpE	Geobacter lovleyi SZ Gene: Glov_2830: Heat shock protein GrpE	Pelobacter propionicus DSM 2379 Gene: Ppro_1405: Heat shock protein GrpE	Pelobacter carbinolicus str. DSM 2380 Gene: Pcar_0108: Heat shock protein GrpE	Desulfuromonas acetoxidans DSM 684 Gene: Dace_0266: Heat shock protein GrpE	Heat shock protein GrpE
dnaK	Geobacter metallireducens GS-15 Gene: Gmet_3532: Chaperone protein DnaK	Geobacter sulfurreducens PCA Gene: GSU0033: Chaperone protein DnaK	Geobacter uraniumreducens Rf4 Gene: Gura_0211: Chaperone protein DnaK	Geobacter sp. FRC-32 Gene: Geob_1107: Chaperone protein DnaK	Geobacter sp. M21 Gene: GM21_3574: Chaperone protein DnaK	Geobacter lovleyi SZ Gene: Glov_2829: Chaperone protein DnaK	Pelobacter propionicus DSM 2379 Gene: Ppro_1404: Chaperone protein DnaK	Pelobacter carbinolicus str. DSM 2380 Gene: Pcar_0107: Chaperone protein DnaK	Desulfuromonas acetoxidans DSM 684 Gene: Dace_0265: Chaperone protein DnaK	Chaperone protein DnaK
dnaJ	Geobacter metallireducens GS-15 Gene: Gmet_3531: Chaperone protein DnaJ	Geobacter sulfurreducens PCA Gene: GSU0034: Chaperone protein DnaJ	Geobacter uraniumreducens Rf4 Gene: Gura_0212: Chaperone protein DnaJ	Geobacter sp. FRC-32 Gene: Geob_1108: Chaperone protein DnaJ	Geobacter sp. M21 Gene: GM21_3573: Chaperone protein DnaJ	Geobacter lovleyi SZ Gene: Glov_2828: Chaperone protein DnaJ	Pelobacter propionicus DSM 2379 Gene: Ppro_1403: Chaperone protein DnaJ	Pelobacter carbinolicus str. DSM 2380 Gene: Pcar_0106: Chaperone protein DnaJ	Desulfuromonas acetoxidans DSM 684 Gene: Dace_0264: Chaperone protein DnaJ	Chaperone protein DnaJ

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog HrcA - Desulfuromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --