Regulon of HrcA in Pelobacter propionicus DSM 2379

Properties
Regulator type:	Transcription factor
TF locus tag:	Ppro_1406
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfuromonadales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.8 Sequence: TTAGCACTCTCCAGTCATGAGTGCTAT Locus tag: Ppro_1406 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Ppro_1405 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Ppro_1404 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Ppro_1403 Name: dnaJ Funciton: Chaperone protein DnaJ
	Ppro_1406	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Ppro_1405	grpE	Heat shock protein GrpE
	Ppro_1404	dnaK	Chaperone protein DnaK
	Ppro_1403	dnaJ	Chaperone protein DnaJ
Position: -77 Score: 7.3 Sequence: TTAGCACTCGGTCATCGTGAGTGCTAA Locus tag: Ppro_2803 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Ppro_2802 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Ppro_2803	groS	Heat shock protein 60 family co-chaperone GroES
	Ppro_2802	groL	Heat shock protein 60 family chaperone GroEL
Position: -63 Score: 6.6 Sequence: TTGGCAGTCGGACGGCTTGAGTGCTAA Locus tag: Ppro_0664 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Ppro_0664	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Position: -56 Score: 6.9 Sequence: TTAGCAGTCACCGCACGAGAGTGCTAA Locus tag: Ppro_0114 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Ppro_0114	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD