Regulon of HrcA in Geobacter uraniumreducens Rf4

Properties
Regulator type:	Transcription factor
TF locus tag:	Gura_0209
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfuromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 7.2 Sequence: TTAGCACTCGGCAGCTTGGAGTGCTAA Locus tag: Gura_4306 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Gura_4307 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Gura_4306	groS	Heat shock protein 60 family co-chaperone GroES
	Gura_4307	groL	Heat shock protein 60 family chaperone GroEL
Position: -92 Score: 6.8 Sequence: TTAGCACTCTTAACTTGAGAGTGCCAA Locus tag: Gura_3950 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Gura_3950	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Position: -47 Score: 7.4 Sequence: TTAGCACTCGAATTCCTTGAGTGCTAA Locus tag: Gura_0209 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Gura_0210 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Gura_0211 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Gura_0212 Name: dnaJ Funciton: Chaperone protein DnaJ
	Gura_0209	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Gura_0210	grpE	Heat shock protein GrpE
	Gura_0211	dnaK	Chaperone protein DnaK
	Gura_0212	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD