Regulon of HrcA in Geobacter metallireducens GS-15

Properties
Regulator type:	Transcription factor
TF locus tag:	Gmet_3534
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfuromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 7.4 Sequence: TTAGCACTCACCAACTCTGAGTGCTAA Locus tag: Gmet_3534 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Gmet_3533 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Gmet_3532 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Gmet_3531 Name: dnaJ Funciton: Chaperone protein DnaJ
	Gmet_3534	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Gmet_3533	grpE	Heat shock protein GrpE
	Gmet_3532	dnaK	Chaperone protein DnaK
	Gmet_3531	dnaJ	Chaperone protein DnaJ
Position: -81 Score: 7.4 Sequence: TTAGCACTCAGCTGTATCGAGTGCTAA Locus tag: Gmet_0028 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Gmet_0029 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Gmet_0028	groS	Heat shock protein 60 family co-chaperone GroES
	Gmet_0029	groL	Heat shock protein 60 family chaperone GroEL
Position: -64 Score: 7.3 Sequence: TTAGCACTCAGACAAACCGAGTGCTAA Locus tag: Gmet_2854 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Gmet_2854	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD