Regulon of HrcA in Geobacter lovleyi SZ

Properties
Regulator type:	Transcription factor
TF locus tag:	Glov_2831
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfuromonadales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -79 Score: 6.9 Sequence: TTAGCACTCACCGCTTTAGAGTGCTAG Locus tag: Glov_2928 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Glov_2929 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Glov_2928	groS	Heat shock protein 60 family co-chaperone GroES
	Glov_2929	groL	Heat shock protein 60 family chaperone GroEL
Position: -79 Score: 7.4 Sequence: TTAGCACTCAAGTTTATAGAGTGCTAA Locus tag: Glov_2831 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: Glov_2830 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Glov_2829 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Glov_2828 Name: dnaJ Funciton: Chaperone protein DnaJ
	Glov_2831	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	Glov_2830	grpE	Heat shock protein GrpE
	Glov_2829	dnaK	Chaperone protein DnaK
	Glov_2828	dnaJ	Chaperone protein DnaJ
Position: -56 Score: 7.1 Sequence: TTAGCAGTCAGCACCATAGAGTGCTAA Locus tag: Glov_0181 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Glov_0181	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Position: -51 Score: 6.9 Sequence: TTAGCAGTCTTGTGTGTCGAGTGCTAA Locus tag: Glov_1330 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	Glov_1330	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD