Regulon of HrcA in Geobacter sulfurreducens PCA

Properties
Regulator type:	Transcription factor
TF locus tag:	GSU0031
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Desulfuromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By taxonomy - Desulfuromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 7.4 Sequence: TTAGCACTCACGTCCCTTGAGTGCTAA Locus tag: GSU0031 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: GSU0032 Name: grpE Funciton: Heat shock protein GrpE Locus tag: GSU0033 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: GSU0034 Name: dnaJ Funciton: Chaperone protein DnaJ
	GSU0031	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	GSU0032	grpE	Heat shock protein GrpE
	GSU0033	dnaK	Chaperone protein DnaK
	GSU0034	dnaJ	Chaperone protein DnaJ
Position: -52 Score: 7.4 Sequence: TTAGCACTCAGACGTACCGAGTGCTAA Locus tag: GSU0655 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	GSU0655	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Position: -80 Score: 7.4 Sequence: TTAGCACTCAGTCGTATCGAGTGCTAA Locus tag: GSU3339 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: GSU3340 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	GSU3339	groS	Heat shock protein 60 family co-chaperone GroES
	GSU3340	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD