Regulog AglR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Alpha-glucosides utilization |
| Effector: | Alpha-glucoside; Maltose; Trehalose; Sucrose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Alpha-glucoside
- By effector - Maltose
- By effector - Trehalose
- By effector - Sucrose
- By pathway - Alpha-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 6 | 2 |
| Rhizobium etli CFN 42 | 6 | 2 |
| Rhizobium leguminosarum bv. viciae 3841 | 8 | 3 |
| Sinorhizobium meliloti 1021 | 6 | 2 |
| Mesorhizobium loti MAFF303099 | 6 | 2 |
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Mesorhizobium sp. BNC1 | 5 | 2 |
| Rhizobium sp. NGR234 | 6 | 2 |
| Bartonella quintana str. Toulouse | ||
| Brucella melitensis 16M | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 | ||
| Rhodopseudomonas palustris CGA009 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| aglE |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -221 score = 5.50016 sequence = TTCCCAAAGCGCTTTAGATT Site: position = -64 score = 6.07398 sequence = TAGCCAAAGCGCTTTGATTG Gene: Atu0591: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
*
Rhizobium etli CFN 42 Site: position = -236 score = 5.74227 sequence = CGCTCAAAGCGCTTTTAATT Site: position = -73 score = 6.41074 sequence = GTGTCAAAGCGCTTTGAAAT Gene: RHE_CH00696: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -245 score = 5.86075 sequence = CATCCAAAGCGCTTTCAATT Site: position = -73 score = 6.25159 sequence = GGGTCAAAGCGCTTTGAAAT Gene: RL0745: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
*
Sinorhizobium meliloti 1021 Site: position = -104 score = 6.56409 sequence = AACTCAAAGCGCTTTGAATG Gene: SMc03061: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
*
Mesorhizobium loti MAFF303099 Site: position = -138 score = 6.16376 sequence = AAGCCAAAGCGCTTTGGAAG Gene: mll5113: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -105 score = 6.16259 sequence = TTCTCAAAGCGCTTTGAGCT Gene: Meso_2855: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
*
Rhizobium sp. NGR234 Site: position = -83 score = 6.53738 sequence = AACTCAAAGCGCTTTGAATA Gene: NGR_c03100: Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
|
|
|
|
|
Alpha-glucoside ABC transporter periplasmic sugar-binding protein |
| aglF |
Gene: Atu0592: Alpha-glucoside ABC transporter permease protein |
Gene: RHE_CH00697: Alpha-glucoside ABC transporter permease protein |
Gene: RL0746: Alpha-glucoside ABC transporter permease protein |
Gene: SMc03062: Alpha-glucoside ABC transporter permease protein |
Gene: mll5112: Alpha-glucoside ABC transporter permease protein |
|
|
|
Gene: Meso_2856: Alpha-glucoside ABC transporter permease protein |
Gene: NGR_c03110: Alpha-glucoside ABC transporter permease protein |
|
|
|
|
|
Alpha-glucoside ABC transporter permease protein |
| aglG |
Gene: Atu0593: Alpha-glucoside ABC transporter permease protein |
Gene: RHE_CH00698: Alpha-glucoside ABC transporter permease protein |
Gene: RL0747: Alpha-glucoside ABC transporter permease protein |
Gene: SMc03063: Alpha-glucoside ABC transporter permease protein |
Gene: mll5110: Alpha-glucoside ABC transporter permease protein |
|
|
|
Gene: Meso_2857: Alpha-glucoside ABC transporter permease protein |
Gene: NGR_c03120: Alpha-glucoside ABC transporter permease protein |
|
|
|
|
|
Alpha-glucoside ABC transporter permease protein |
| aglA |
Gene: Atu0594: Alpha-glucosidase AglA |
Gene: RHE_CH00699: Alpha-glucosidase AglA |
Gene: RL0748: Alpha-glucosidase AglA |
Gene: SMc03064: Alpha-glucosidase AglA |
Gene: mll5109: Alpha-glucosidase AglA |
|
|
|
|
Gene: NGR_c03130: Alpha-glucosidase AglA |
|
|
|
|
|
Alpha-glucosidase AglA |
| aglK |
Gene: Atu0595: Alpha-glucoside transport ATP-binding protein AglK |
Gene: RHE_CH00700: Alpha-glucoside transport ATP-binding protein AglK |
Gene: RL0749: Alpha-glucoside transport ATP-binding protein AglK |
Gene: SMc03065: Alpha-glucoside transport ATP-binding protein AglK |
Gene: mll5107: Alpha-glucoside transport ATP-binding protein AglK |
|
|
|
Gene: Meso_2858: Alpha-glucoside transport ATP-binding protein AglK |
Gene: NGR_c03140: Alpha-glucoside transport ATP-binding protein AglK |
|
|
|
|
|
Alpha-glucoside ABC transporter ATP-binding protein |
| CRON 2. | ||||||||||||||||
| thuA |
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -66 score = 6.20772 sequence = TTTCCAAAGCGCTTTGAATC Gene: RL3686: Trehalose utilization protein |
|
|
|
|
|
|
|
|
|
|
|
|
Trehalose utilization protein |
| RL3685 |
|
|
Gene: RL3685: Oxidoreductase (EC 1.1.1.-) |
|
|
|
|
|
|
|
|
|
|
|
|
Oxidoreductase (EC 1.1.1.-) |
| CRON 3. | ||||||||||||||||
| aglR |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -76 score = 5.50016 sequence = AATCTAAAGCGCTTTGGGAA Site: position = -233 score = 6.07398 sequence = CAATCAAAGCGCTTTGGCTA Gene: Atu0590: Transcriptional regulator of alpha-glucoside utilization, LacI family |
*
Rhizobium etli CFN 42 Site: position = -244 score = 6.41074 sequence = ATTTCAAAGCGCTTTGACAC Site: position = -81 score = 5.74227 sequence = AATTAAAAGCGCTTTGAGCG Gene: RHE_CH00695: Transcriptional regulator of alpha-glucoside utilization, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -256 score = 6.25159 sequence = ATTTCAAAGCGCTTTGACCC Site: position = -84 score = 5.86075 sequence = AATTGAAAGCGCTTTGGATG Gene: RL0744: Transcriptional regulator of alpha-glucoside utilization, LacI family |
*
Sinorhizobium meliloti 1021 Site: position = -30 score = 6.26624 sequence = TATTCAAAGCGCTTTGGAAG Site: position = -233 score = 6.56409 sequence = CATTCAAAGCGCTTTGAGTT Gene: SMc03060: Transcriptional regulator of alpha-glucoside utilization, LacI family |
*
Mesorhizobium loti MAFF303099 Site: position = -240 score = 6.16376 sequence = CTTCCAAAGCGCTTTGGCTT Site: position = -21 score = 5.4071 sequence = ATTTAAAAGCGCTTTGAGGG Gene: mlr5115: Transcriptional regulator of alpha-glucoside utilization, LacI family |
|
|
|
*
Mesorhizobium sp. BNC1 Site: position = -127 score = 6.16259 sequence = AGCTCAAAGCGCTTTGAGAA Gene: Meso_2854: Transcriptional regulator of alpha-glucoside utilization, LacI family |
*
Rhizobium sp. NGR234 Site: position = -30 score = 6.18867 sequence = TATCCAAAGCGCTTTGAGAG Site: position = -235 score = 6.53738 sequence = TATTCAAAGCGCTTTGAGTT Gene: NGR_c03090: Transcriptional regulator of alpha-glucoside utilization, LacI family |
|
|
|
|
|
Transcriptional regulator of alpha-glucoside utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |