Orthologous regulated operons containing aglE gene

Properties
Regulog:	AglR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Trehalose; Sucrose
Phylum:	Proteobacteria/Alpha

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -221 Score: 5.50016 Sequence: TTCCCAAAGCGCTTTAGATT Position: -64 Score: 6.07398 Sequence: TAGCCAAAGCGCTTTGATTG Locus tag: Atu0591 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: Atu0592 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Atu0593 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Atu0594 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: Atu0595 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK	-221	5.5	TTCCCAAAGCGCTTTAGATT	Atu0591
	-64	6.1	TAGCCAAAGCGCTTTGATTG
Mesorhizobium loti MAFF303099
Position: -138 Score: 6.16376 Sequence: AAGCCAAAGCGCTTTGGAAG Locus tag: mll5113 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: mll5112 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: mll5110 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: mll5109 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: mll5107 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK	-138	6.2	AAGCCAAAGCGCTTTGGAAG	mll5113
Mesorhizobium sp. BNC1
Position: -105 Score: 6.16259 Sequence: TTCTCAAAGCGCTTTGAGCT Locus tag: Meso_2855 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: Meso_2856 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Meso_2857 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Meso_2858 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglK	-105	6.2	TTCTCAAAGCGCTTTGAGCT	Meso_2855
Rhizobium etli CFN 42
Position: -236 Score: 5.74227 Sequence: CGCTCAAAGCGCTTTTAATT Position: -73 Score: 6.41074 Sequence: GTGTCAAAGCGCTTTGAAAT Locus tag: RHE_CH00696 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: RHE_CH00697 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RHE_CH00698 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RHE_CH00699 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: RHE_CH00700 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK	-236	5.7	CGCTCAAAGCGCTTTTAATT	RHE_CH00696
	-73	6.4	GTGTCAAAGCGCTTTGAAAT
Rhizobium leguminosarum bv. viciae 3841
Position: -245 Score: 5.86075 Sequence: CATCCAAAGCGCTTTCAATT Position: -73 Score: 6.25159 Sequence: GGGTCAAAGCGCTTTGAAAT Locus tag: RL0745 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: RL0746 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RL0747 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RL0748 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: RL0749 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK	-245	5.9	CATCCAAAGCGCTTTCAATT	RL0745
	-73	6.3	GGGTCAAAGCGCTTTGAAAT
Rhizobium sp. NGR234
Position: -83 Score: 6.53738 Sequence: AACTCAAAGCGCTTTGAATA Locus tag: NGR_c03100 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: NGR_c03110 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: NGR_c03120 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: NGR_c03130 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: NGR_c03140 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK	-83	6.5	AACTCAAAGCGCTTTGAATA	NGR_c03100
Sinorhizobium meliloti 1021
Position: -104 Score: 6.56409 Sequence: AACTCAAAGCGCTTTGAATG Locus tag: SMc03061 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: SMc03062 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SMc03063 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SMc03064 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: SMc03065 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
aglE-aglF-aglG-aglA-aglK	-104	6.6	AACTCAAAGCGCTTTGAATG	SMc03061

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing aglE gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --