Regulon of AglR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c03090
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog:	AglR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Trehalose
By effector - Sucrose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.5 Sequence: AACTCAAAGCGCTTTGAATA Locus tag: NGR_c03100 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: NGR_c03110 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: NGR_c03120 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: NGR_c03130 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: NGR_c03140 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
	NGR_c03100	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	NGR_c03110	aglF	Alpha-glucoside ABC transporter permease protein
	NGR_c03120	aglG	Alpha-glucoside ABC transporter permease protein
	NGR_c03130	aglA	Alpha-glucosidase AglA
	NGR_c03140	aglK	Alpha-glucoside transport ATP-binding protein AglK
Position: -235 Score: 6.5 Sequence: TATTCAAAGCGCTTTGAGTT Position: -30 Score: 6.2 Sequence: TATCCAAAGCGCTTTGAGAG Locus tag: NGR_c03090 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
	NGR_c03090	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD