Regulon of AglR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMc03060
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog:	AglR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Trehalose
By effector - Sucrose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -104 Score: 6.6 Sequence: AACTCAAAGCGCTTTGAATG Locus tag: SMc03061 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: SMc03062 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SMc03063 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: SMc03064 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: SMc03065 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
	SMc03061	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	SMc03062	aglF	Alpha-glucoside ABC transporter permease protein
	SMc03063	aglG	Alpha-glucoside ABC transporter permease protein
	SMc03064	aglA	Alpha-glucosidase AglA
	SMc03065	aglK	Alpha-glucoside transport ATP-binding protein AglK
Position: -233 Score: 6.6 Sequence: CATTCAAAGCGCTTTGAGTT Position: -30 Score: 6.3 Sequence: TATTCAAAGCGCTTTGGAAG Locus tag: SMc03060 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
	SMc03060	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD