Regulon of AglR in Mesorhizobium sp. BNC1

Properties
Regulator type:	Transcription factor
TF locus tag:	Meso_2854
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog:	AglR - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Trehalose
By effector - Sucrose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 6.2 Sequence: TTCTCAAAGCGCTTTGAGCT Locus tag: Meso_2855 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: Meso_2856 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Meso_2857 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: Meso_2858 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
	Meso_2855	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	Meso_2856	aglF	Alpha-glucoside ABC transporter permease protein
	Meso_2857	aglG	Alpha-glucoside ABC transporter permease protein
	Meso_2858	aglK	Alpha-glucoside transport ATP-binding protein AglK
Position: -127 Score: 6.2 Sequence: AGCTCAAAGCGCTTTGAGAA Locus tag: Meso_2854 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
	Meso_2854	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD