Regulon of AglR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL0744
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog:	AglR - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Trehalose
By effector - Sucrose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -245 Score: 5.9 Sequence: CATCCAAAGCGCTTTCAATT Position: -73 Score: 6.3 Sequence: GGGTCAAAGCGCTTTGAAAT Locus tag: RL0745 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: RL0746 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RL0747 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: RL0748 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: RL0749 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
	RL0745	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	RL0746	aglF	Alpha-glucoside ABC transporter permease protein
	RL0747	aglG	Alpha-glucoside ABC transporter permease protein
	RL0748	aglA	Alpha-glucosidase AglA
	RL0749	aglK	Alpha-glucoside transport ATP-binding protein AglK
Position: -256 Score: 6.3 Sequence: ATTTCAAAGCGCTTTGACCC Position: -84 Score: 5.9 Sequence: AATTGAAAGCGCTTTGGATG Locus tag: RL0744 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
	RL0744	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family
Position: -66 Score: 6.2 Sequence: TTTCCAAAGCGCTTTGAATC Locus tag: RL3686 Name: thuA Funciton: Trehalose utilization protein Locus tag: RL3685 Name: null Funciton: Oxidoreductase (EC 1.1.1.-)
	RL3686	thuA	Trehalose utilization protein
	RL3685		Oxidoreductase (EC 1.1.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD