Regulon of AglR in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr5115
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Alpha-glucosides utilization
Effector:	Alpha-glucoside; Maltose; Trehalose; Sucrose
Regulog:	AglR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Alpha-glucoside
By effector - Maltose
By effector - Trehalose
By effector - Sucrose
By pathway - Alpha-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -240 Score: 6.2 Sequence: CTTCCAAAGCGCTTTGGCTT Position: -21 Score: 5.4 Sequence: ATTTAAAAGCGCTTTGAGGG Locus tag: mlr5115 Name: aglR Funciton: Transcriptional regulator of alpha-glucoside utilization, LacI family
	mlr5115	aglR	Transcriptional regulator of alpha-glucoside utilization, LacI family
Position: -138 Score: 6.2 Sequence: AAGCCAAAGCGCTTTGGAAG Locus tag: mll5113 Name: aglE Funciton: Alpha-glucoside ABC transporter periplasmic sugar-binding protein Locus tag: mll5112 Name: aglF Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: mll5110 Name: aglG Funciton: Alpha-glucoside ABC transporter permease protein Locus tag: mll5109 Name: aglA Funciton: Alpha-glucosidase AglA Locus tag: mll5107 Name: aglK Funciton: Alpha-glucoside transport ATP-binding protein AglK
	mll5113	aglE	Alpha-glucoside ABC transporter periplasmic sugar-binding protein
	mll5112	aglF	Alpha-glucoside ABC transporter permease protein
	mll5110	aglG	Alpha-glucoside ABC transporter permease protein
	mll5109	aglA	Alpha-glucosidase AglA
	mll5107	aglK	Alpha-glucoside transport ATP-binding protein AglK

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD