Regulog NagR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - ROK
- By effector - N-acetylglucosamine
- By pathway - N-acetylglucosamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||
| Chloroflexus sp. Y-400-fl | 9 | 1 |
| Herpetosiphon aurantiacus ATCC 23779 | 9 | 1 |
| Roseiflexus castenholzii DSM 13941 | 2 | 1 |
| Roseiflexus sp. RS-1 | 2 | 1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| nagR |
|
*
Chloroflexus sp. Y-400-fl Site: position = -39 score = 6.77627 sequence = TTGTTAGTTCATTGGACTATCTA Gene: Chy400_1208: Predicted N-acetyl-glucosamine repressor, ROK family |
*
Herpetosiphon aurantiacus ATCC 23779 Site: position = -23 score = 4.30592 sequence = TAGTAAATTCATTGGAATAAGTT Site: position = -418 score = 4.89981 sequence = GTAATGGTTCATTGGGTTAACAA Gene: Haur_1182: Predicted N-acetyl-glucosamine repressor, ROK family |
*
Roseiflexus castenholzii DSM 13941 Site: position = -132 score = 6.87794 sequence = TTGTCAGTTCAATGGACTAACAC Gene: Rcas_0477: Predicted N-acetyl-glucosamine repressor, ROK family |
*
Roseiflexus sp. RS-1 Site: position = -126 score = 6.67461 sequence = TTGTCAGTTCACTGAACTAATGA Gene: RoseRS_4247: Predicted N-acetyl-glucosamine repressor, ROK family |
Predicted N-acetyl-glucosamine repressor, ROK family |
| age |
|
Gene: Chy400_1209: N-acylglucosamine 2-epimerase (EC 5.1.3.8) |
|
Gene: Rcas_3784: N-acylglucosamine 2-epimerase (EC 5.1.3.8) |
Gene: RoseRS_1977: N-acylglucosamine 2-epimerase (EC 5.1.3.8) |
N-acylglucosamine 2-epimerase (EC 5.1.3.8) |
| Chy400_1210 |
|
Gene: Chy400_1210: hypothetical protein |
|
|
|
hypothetical protein |
| chiE |
|
Gene: Chy400_1211: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like) |
|
|
|
Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like) |
| chiF |
|
Gene: Chy400_1212: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like) |
|
|
|
Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like) |
| chiG |
|
Gene: Chy400_1213: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like) |
|
|
|
Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like) |
| Chy400_1214 |
|
Gene: Chy400_1214: glycoside hydrolase family 38 |
|
|
|
glycoside hydrolase family 38 |
| hex2 |
|
Gene: Chy400_1215: Beta-hexosaminidase |
|
|
|
Beta-hexosaminidase |
| nagB |
|
Gene: Chy400_1216: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) |
Gene: Haur_1174: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) |
Gene: Rcas_3111: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) |
Gene: RoseRS_2367: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) |
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6) |
| nagK |
|
|
Gene: Haur_1181: Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59) |
|
|
Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59) |
| chbA |
|
|
Gene: Haur_1180: Predicted chitobiose ABC transporter, periplasmic component |
|
|
Predicted chitobiose ABC transporter, periplasmic component |
| chbB |
|
|
Gene: Haur_1179: Predicted chitobiose ABC transporter, permease component 1 |
|
|
Predicted chitobiose ABC transporter, permease component 1 |
| chbC |
|
|
Gene: Haur_1178: Predicted chitobiose ABC transporter, permease component 2 |
|
|
Predicted chitobiose ABC transporter, permease component 2 |
| hex |
|
|
Gene: Haur_1177: Beta-hexosaminidase (EC 3.2.1.52) |
|
|
Beta-hexosaminidase (EC 3.2.1.52) |
| Haur_1176 |
|
|
Gene: Haur_1176: hypothetical protein |
|
|
hypothetical protein |
| nagA |
|
|
Gene: Haur_1175: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
|
|
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
| Rcas_0478 |
|
|
|
Gene: Rcas_0478: Predicted N-acetylglucosamine ABC transporter, sugar-binding component |
Gene: RoseRS_4248: Predicted N-acetylglucosamine ABC transporter, sugar-binding component |
Predicted N-acetylglucosamine ABC transporter, sugar-binding component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |