Regulog NagR - Chloroflexia

Properties
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Phylum:	Chloroflexi
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ROK
By effector - N-acetylglucosamine
By pathway - N-acetylglucosamine utilization

Statistics of regulated genes
Genome	Genes	Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl	9	1
Herpetosiphon aurantiacus ATCC 23779	9	1
Roseiflexus castenholzii DSM 13941	2	1
Roseiflexus sp. RS-1	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes						Function

CRON 1.
nagR	Chloroflexus aggregans DSM 9485	* Chloroflexus sp. Y-400-fl Site: position = -39 score = 6.77627 sequence = TTGTTAGTTCATTGGACTATCTA Gene: Chy400_1208: Predicted N-acetyl-glucosamine repressor, ROK family	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -23 score = 4.30592 sequence = TAGTAAATTCATTGGAATAAGTT Site: position = -418 score = 4.89981 sequence = GTAATGGTTCATTGGGTTAACAA Gene: Haur_1182: Predicted N-acetyl-glucosamine repressor, ROK family	* Roseiflexus castenholzii DSM 13941 Site: position = -132 score = 6.87794 sequence = TTGTCAGTTCAATGGACTAACAC Gene: Rcas_0477: Predicted N-acetyl-glucosamine repressor, ROK family	* Roseiflexus sp. RS-1 Site: position = -126 score = 6.67461 sequence = TTGTCAGTTCACTGAACTAATGA Gene: RoseRS_4247: Predicted N-acetyl-glucosamine repressor, ROK family	Predicted N-acetyl-glucosamine repressor, ROK family
age	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1209: N-acylglucosamine 2-epimerase (EC 5.1.3.8)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3784: N-acylglucosamine 2-epimerase (EC 5.1.3.8)	Roseiflexus sp. RS-1 Gene: RoseRS_1977: N-acylglucosamine 2-epimerase (EC 5.1.3.8)	N-acylglucosamine 2-epimerase (EC 5.1.3.8)
Chy400_1210	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1210: hypothetical protein	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	hypothetical protein
chiE	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1211: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
chiF	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1212: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
chiG	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1213: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
Chy400_1214	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1214: glycoside hydrolase family 38	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	glycoside hydrolase family 38
hex2	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1215: Beta-hexosaminidase	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Beta-hexosaminidase
nagB	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_1216: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1174: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3111: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Roseiflexus sp. RS-1 Gene: RoseRS_2367: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)	Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagK	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1181: Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)
chbA	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1180: Predicted chitobiose ABC transporter, periplasmic component	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted chitobiose ABC transporter, periplasmic component
chbB	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1179: Predicted chitobiose ABC transporter, permease component 1	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted chitobiose ABC transporter, permease component 1
chbC	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1178: Predicted chitobiose ABC transporter, permease component 2	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted chitobiose ABC transporter, permease component 2
hex	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1177: Beta-hexosaminidase (EC 3.2.1.52)	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Beta-hexosaminidase (EC 3.2.1.52)
Haur_1176	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1176: hypothetical protein	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	hypothetical protein
nagA	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_1175: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
Rcas_0478	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0478: Predicted N-acetylglucosamine ABC transporter, sugar-binding component	Roseiflexus sp. RS-1 Gene: RoseRS_4248: Predicted N-acetylglucosamine ABC transporter, sugar-binding component	Predicted N-acetylglucosamine ABC transporter, sugar-binding component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NagR - Chloroflexia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --