Regulon of NagR in Herpetosiphon aurantiacus ATCC 23779

Properties
Regulator type:	Transcription factor
TF locus tag:	Haur_1182
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Regulog:	NagR - Chloroflexia
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ROK
By effector - N-acetylglucosamine
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -418 Score: 4.9 Sequence: GTAATGGTTCATTGGGTTAACAA Position: -23 Score: 4.3 Sequence: TAGTAAATTCATTGGAATAAGTT Locus tag: Haur_1182 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: Haur_1181 Name: nagK Funciton: Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59) Locus tag: Haur_1180 Name: chbA Funciton: Predicted chitobiose ABC transporter, periplasmic component Locus tag: Haur_1179 Name: chbB Funciton: Predicted chitobiose ABC transporter, permease component 1 Locus tag: Haur_1178 Name: chbC Funciton: Predicted chitobiose ABC transporter, permease component 2 Locus tag: Haur_1177 Name: hex Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: Haur_1176 Name: null Funciton: hypothetical protein Locus tag: Haur_1175 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) Locus tag: Haur_1174 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
	Haur_1182	nagR	Predicted N-acetyl-glucosamine repressor, ROK family
	Haur_1181	nagK	Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59)
	Haur_1180	chbA	Predicted chitobiose ABC transporter, periplasmic component
	Haur_1179	chbB	Predicted chitobiose ABC transporter, permease component 1
	Haur_1178	chbC	Predicted chitobiose ABC transporter, permease component 2
	Haur_1177	hex	Beta-hexosaminidase (EC 3.2.1.52)
	Haur_1176		hypothetical protein
	Haur_1175	nagA	N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
	Haur_1174	nagB	Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD