Regulon of NagR in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_1208
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Regulog:	NagR - Chloroflexia
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ROK
By effector - N-acetylglucosamine
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 6.8 Sequence: TTGTTAGTTCATTGGACTATCTA Locus tag: Chy400_1208 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: Chy400_1209 Name: age Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8) Locus tag: Chy400_1210 Name: null Funciton: hypothetical protein Locus tag: Chy400_1211 Name: chiE Funciton: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like) Locus tag: Chy400_1212 Name: chiF Funciton: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like) Locus tag: Chy400_1213 Name: chiG Funciton: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like) Locus tag: Chy400_1214 Name: null Funciton: glycoside hydrolase family 38 Locus tag: Chy400_1215 Name: hex2 Funciton: Beta-hexosaminidase Locus tag: Chy400_1216 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
	Chy400_1208	nagR	Predicted N-acetyl-glucosamine repressor, ROK family
	Chy400_1209	age	N-acylglucosamine 2-epimerase (EC 5.1.3.8)
	Chy400_1210		hypothetical protein
	Chy400_1211	chiE	Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like)
	Chy400_1212	chiF	Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like)
	Chy400_1213	chiG	Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like)
	Chy400_1214		glycoside hydrolase family 38
	Chy400_1215	hex2	Beta-hexosaminidase
	Chy400_1216	nagB	Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD