Regulon of NagR in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_4247
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Regulog:	NagR - Chloroflexia
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - ROK
By effector - N-acetylglucosamine
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 6.7 Sequence: TTGTCAGTTCACTGAACTAATGA Locus tag: RoseRS_4247 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: RoseRS_4248 Name: Rcas_0478 Funciton: Predicted N-acetylglucosamine ABC transporter, sugar-binding component
	RoseRS_4247	nagR	Predicted N-acetyl-glucosamine repressor, ROK family
	RoseRS_4248	Rcas_0478	Predicted N-acetylglucosamine ABC transporter, sugar-binding component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD