Orthologous regulated operons containing nagB gene

Properties
Regulog:	NagR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Phylum:	Chloroflexi

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -39 Score: 6.77627 Sequence: TTGTTAGTTCATTGGACTATCTA Locus tag: Chy400_1208 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: Chy400_1209 Name: age Funciton: N-acylglucosamine 2-epimerase (EC 5.1.3.8) Locus tag: Chy400_1210 Name: null Funciton: hypothetical protein Locus tag: Chy400_1211 Name: chiE Funciton: Predicted chitobiose ABC transport system, sugar-binding protein (Thermotoga-like) Locus tag: Chy400_1212 Name: chiF Funciton: Predicted chitobiose ABC transport system, permease protein 1 (Thermotoga-like) Locus tag: Chy400_1213 Name: chiG Funciton: Predicted chitobiose ABC transport system, permease protein 2 (Thermotoga-like) Locus tag: Chy400_1214 Name: null Funciton: glycoside hydrolase family 38 Locus tag: Chy400_1215 Name: hex2 Funciton: Beta-hexosaminidase Locus tag: Chy400_1216 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagR-age-Chy400_1210-chiE-chiF-chiG-Chy400_1214-hex2-nagB	-39	6.8	TTGTTAGTTCATTGGACTATCTA	Chy400_1208
Herpetosiphon aurantiacus ATCC 23779
Position: -418 Score: 4.89981 Sequence: GTAATGGTTCATTGGGTTAACAA Position: -23 Score: 4.30592 Sequence: TAGTAAATTCATTGGAATAAGTT Locus tag: Haur_1182 Name: nagR Funciton: Predicted N-acetyl-glucosamine repressor, ROK family Locus tag: Haur_1181 Name: nagK Funciton: Predicted N-acetyl-glucosamine kinase, ROK family (EC 2.7.1.59) Locus tag: Haur_1180 Name: chbA Funciton: Predicted chitobiose ABC transporter, periplasmic component Locus tag: Haur_1179 Name: chbB Funciton: Predicted chitobiose ABC transporter, permease component 1 Locus tag: Haur_1178 Name: chbC Funciton: Predicted chitobiose ABC transporter, permease component 2 Locus tag: Haur_1177 Name: hex Funciton: Beta-hexosaminidase (EC 3.2.1.52) Locus tag: Haur_1176 Name: null Funciton: hypothetical protein Locus tag: Haur_1175 Name: nagA Funciton: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) Locus tag: Haur_1174 Name: nagB Funciton: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagR-nagK-chbA-chbB-chbC-hex-Haur_1176-nagA-nagB	-418	4.9	GTAATGGTTCATTGGGTTAACAA	Haur_1182
	-23	4.3	TAGTAAATTCATTGGAATAAGTT