Regulog HTCS_Ara-1 - Bacteroidaceae
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | activator |
| Biological process: | Arabinan utilization |
| Effector: | Arabinan |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacteroidaceae
- By TF family - [Other]
- By effector - Arabinan
- By pathway - Arabinan utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | 3 | 1 |
| Bacteroides coprophilus DSM 18228 | ||
| Bacteroides dorei DSM 17855 | 6 | 2 |
| Bacteroides eggerthii DSM 20697 | 7 | 2 |
| Bacteroides fragilis NCTC 9343 | ||
| Bacteroides ovatus ATCC 8483 | ||
| Bacteroides plebeius DSM 17135 | 5 | 2 |
| Bacteroides stercoris ATCC 43183 | ||
| Bacteroides thetaiotaomicron VPI-5482 | 9 | 2 |
| Bacteroides uniformis ATCC 8492 | ||
| Bacteroides vulgatus ATCC 8482 | 6 | 2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| abn2 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -268 score = 7.75675 sequence = TGTCCACCTCAAATGTTCATTTGTCCACCT Gene: BACCELL_05304: Arabinan endo-1,5-alpha-L-arabinosidase |
|
*
Bacteroides dorei DSM 17855 Site: position = -159 score = 7.44087 sequence = TGTCCACCCTTTAAGCGATATTGTCCACCT Gene: BACDOR_01716: Arabinan endo-1,5-alpha-L-arabinosidase |
*
Bacteroides eggerthii DSM 20697 Site: position = -285 score = 7.43576 sequence = TGTCCACCTTAAAAGGTCATATATCCACCT Gene: BACEGG_01542: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -69 score = 7.00789 sequence = TGTCCACCAATCGTGTTCGTATGTCCACCT Gene: BT0367: Arabinan endo-1,5-alpha-L-arabinosidase |
|
*
Bacteroides vulgatus ATCC 8482 Site: position = -169 score = 7.44087 sequence = TGTCCACCCTTTAAGCGATATTGTCCACCT Gene: BVU_1002: Arabinan endo-1,5-alpha-L-arabinosidase |
Arabinan endo-1,5-alpha-L-arabinosidase |
| abf2 |
Gene: BACCELL_05303: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
Gene: BACDOR_01715: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Gene: BACEGG_01543: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
Gene: BACOVA_01717: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
*
Bacteroides plebeius DSM 17135 Site: position = -153 score = 6.81732 sequence = TGTCCACCCAATAGAAAAATTTGTCCACCT Gene: BACPLE_00641: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
Gene: BT0368: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
Gene: BVU_1001: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
| GH43 |
Gene: BACCELL_05302: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase |
|
|
Gene: BACEGG_01544: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase |
|
|
|
|
Gene: BT0369: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase |
|
|
Hypothetical glycoside hydrolase, family 43, similar to arabinosidase |
| CRON 2. | ||||||||||||
| lamG |
Gene: BACCELL_05402: Concanavalin A-like lectins/glucanases superfamily |
|
|
|
|
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -136 score = 7.55285 sequence = TATCCACCTCGAAAATTCATTTGTCCACCT Gene: BT0365: Concanavalin A-like lectins/glucanases superfamily |
|
|
Concanavalin A-like lectins/glucanases superfamily |
| susC_Ara-1 |
Gene: BACCELL_05403: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0364: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of arabinan oligosaccharides |
| susD-Ara-1 |
Gene: BACCELL_05404: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0363: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
| susC_Ara-2 |
Gene: BACCELL_05405: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0362: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of arabinan oligosaccharides |
| susD_Ara-2 |
Gene: BACCELL_05406: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0361: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
| abn1 |
Gene: BACCELL_05407: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
|
|
|
|
|
Gene: BT0360: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
Arabinan endo-1,5-alpha-L-arabinosidase |
| CRON 3. | ||||||||||||
| susC_Ara-3 |
|
|
*
Bacteroides dorei DSM 17855 Site: position = -291 score = 7.50156 sequence = CGTCCACCCTATAAAACCGTTTGTCCACCC Gene: BACDOR_01719: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
*
Bacteroides eggerthii DSM 20697 Site: position = -328 score = 7.33924 sequence = TATCCACCTCTAAAACCCATTTGTCCACCC Site: position = -349 score = 6.41777 sequence = TCTCTACACTTAAAATTCGTTTATCCACCT Gene: BACEGG_01540: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
*
Bacteroides plebeius DSM 17135 Site: position = -224 score = 7.76473 sequence = TATCCACCTATAAAATTCGTTTGTCCACCT Gene: BACPLE_00643: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
|
*
Bacteroides vulgatus ATCC 8482 Site: position = -265 score = 7.50156 sequence = CGTCCACCCTATAAAACCGTTTGTCCACCC Gene: BVU_1005: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
TonB-dependent outer membrane transporter of arabinan oligosaccharides |
| susD_Ara-3 |
|
|
Gene: BACDOR_01720: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
Gene: BACEGG_01539: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
Gene: BACPLE_00644: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
|
Gene: BVU_1006: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
| BACDOR_01721 |
|
|
Gene: BACDOR_01721: hypothetical protein |
Gene: BACEGG_01538: hypothetical protein |
|
|
Gene: BACPLE_00645: hypothetical protein |
|
|
|
Gene: BVU_1007: hypothetical protein |
hypothetical protein |
| abn3 |
|
|
Gene: BACDOR_01722: Arabinan endo-1,5-alpha-L-arabinosidase |
Gene: BACEGG_01537: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
Gene: BACPLE_00646: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
|
Gene: BVU_1008: Arabinan endo-1,5-alpha-L-arabinosidase |
Arabinan endo-1,5-alpha-L-arabinosidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |