Regulog HTCS_Ara-1 - Bacteroidaceae

Properties
Regulator type:	Transcription factor
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Phylum:	Bacteroidetes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By effector - Arabinan
By pathway - Arabinan utilization

Statistics of regulated genes
Genome	Genes	Operons
Bacteroides cellulosilyticus DSM 14838	3	1
Bacteroides coprophilus DSM 18228
Bacteroides dorei DSM 17855	6	2
Bacteroides eggerthii DSM 20697	7	2
Bacteroides fragilis NCTC 9343
Bacteroides ovatus ATCC 8483
Bacteroides plebeius DSM 17135	5	2
Bacteroides stercoris ATCC 43183
Bacteroides thetaiotaomicron VPI-5482	9	2
Bacteroides uniformis ATCC 8492
Bacteroides vulgatus ATCC 8482	6	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
abn2	* Bacteroides cellulosilyticus DSM 14838 Site: position = -268 score = 7.75675 sequence = TGTCCACCTCAAATGTTCATTTGTCCACCT Gene: BACCELL_05304: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides coprophilus DSM 18228	* Bacteroides dorei DSM 17855 Site: position = -159 score = 7.44087 sequence = TGTCCACCCTTTAAGCGATATTGTCCACCT Gene: BACDOR_01716: Arabinan endo-1,5-alpha-L-arabinosidase	* Bacteroides eggerthii DSM 20697 Site: position = -285 score = 7.43576 sequence = TGTCCACCTTAAAAGGTCATATATCCACCT Gene: BACEGG_01542: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	* Bacteroides thetaiotaomicron VPI-5482 Site: position = -69 score = 7.00789 sequence = TGTCCACCAATCGTGTTCGTATGTCCACCT Gene: BT0367: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides uniformis ATCC 8492	* Bacteroides vulgatus ATCC 8482 Site: position = -169 score = 7.44087 sequence = TGTCCACCCTTTAAGCGATATTGTCCACCT Gene: BVU_1002: Arabinan endo-1,5-alpha-L-arabinosidase	Arabinan endo-1,5-alpha-L-arabinosidase
abf2	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05303: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855 Gene: BACDOR_01715: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Bacteroides eggerthii DSM 20697 Gene: BACEGG_01543: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483 Gene: BACOVA_01717: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	* Bacteroides plebeius DSM 17135 Site: position = -153 score = 6.81732 sequence = TGTCCACCCAATAGAAAAATTTGTCCACCT Gene: BACPLE_00641: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0368: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482 Gene: BVU_1001: Alpha-N-arabinofuranosidase (EC 3.2.1.55)	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
GH43	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05302: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697 Gene: BACEGG_01544: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0369: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	Hypothetical glycoside hydrolase, family 43, similar to arabinosidase

CRON 2.
lamG	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05402: Concanavalin A-like lectins/glucanases superfamily	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	* Bacteroides thetaiotaomicron VPI-5482 Site: position = -136 score = 7.55285 sequence = TATCCACCTCGAAAATTCATTTGTCCACCT Gene: BT0365: Concanavalin A-like lectins/glucanases superfamily	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	Concanavalin A-like lectins/glucanases superfamily
susC_Ara-1	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05403: TonB-dependent outer membrane transporter of arabinan oligosaccharides	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0364: TonB-dependent outer membrane transporter of arabinan oligosaccharides	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD-Ara-1	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05404: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0363: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
susC_Ara-2	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05405: TonB-dependent outer membrane transporter of arabinan oligosaccharides	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0362: TonB-dependent outer membrane transporter of arabinan oligosaccharides	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-2	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05406: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0361: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
abn1	Bacteroides cellulosilyticus DSM 14838 Gene: BACCELL_05407: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855	Bacteroides eggerthii DSM 20697	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482 Gene: BT0360: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482	Arabinan endo-1,5-alpha-L-arabinosidase

CRON 3.
susC_Ara-3	Bacteroides cellulosilyticus DSM 14838	Bacteroides coprophilus DSM 18228	* Bacteroides dorei DSM 17855 Site: position = -291 score = 7.50156 sequence = CGTCCACCCTATAAAACCGTTTGTCCACCC Gene: BACDOR_01719: TonB-dependent outer membrane transporter of arabinan oligosaccharides	* Bacteroides eggerthii DSM 20697 Site: position = -328 score = 7.33924 sequence = TATCCACCTCTAAAACCCATTTGTCCACCC Site: position = -349 score = 6.41777 sequence = TCTCTACACTTAAAATTCGTTTATCCACCT Gene: BACEGG_01540: TonB-dependent outer membrane transporter of arabinan oligosaccharides	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	* Bacteroides plebeius DSM 17135 Site: position = -224 score = 7.76473 sequence = TATCCACCTATAAAATTCGTTTGTCCACCT Gene: BACPLE_00643: TonB-dependent outer membrane transporter of arabinan oligosaccharides	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482	Bacteroides uniformis ATCC 8492	* Bacteroides vulgatus ATCC 8482 Site: position = -265 score = 7.50156 sequence = CGTCCACCCTATAAAACCGTTTGTCCACCC Gene: BVU_1005: TonB-dependent outer membrane transporter of arabinan oligosaccharides	TonB-dependent outer membrane transporter of arabinan oligosaccharides
susD_Ara-3	Bacteroides cellulosilyticus DSM 14838	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855 Gene: BACDOR_01720: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides eggerthii DSM 20697 Gene: BACEGG_01539: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135 Gene: BACPLE_00644: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482 Gene: BVU_1006: Outer membrane polysaccharide binding protein for arabinan oligosaccharides	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
BACDOR_01721	Bacteroides cellulosilyticus DSM 14838	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855 Gene: BACDOR_01721: hypothetical protein	Bacteroides eggerthii DSM 20697 Gene: BACEGG_01538: hypothetical protein	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135 Gene: BACPLE_00645: hypothetical protein	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482 Gene: BVU_1007: hypothetical protein	hypothetical protein
abn3	Bacteroides cellulosilyticus DSM 14838	Bacteroides coprophilus DSM 18228	Bacteroides dorei DSM 17855 Gene: BACDOR_01722: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides eggerthii DSM 20697 Gene: BACEGG_01537: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides fragilis NCTC 9343	Bacteroides ovatus ATCC 8483	Bacteroides plebeius DSM 17135 Gene: BACPLE_00646: Arabinan endo-1,5-alpha-L-arabinosidase	Bacteroides stercoris ATCC 43183	Bacteroides thetaiotaomicron VPI-5482	Bacteroides uniformis ATCC 8492	Bacteroides vulgatus ATCC 8482 Gene: BVU_1008: Arabinan endo-1,5-alpha-L-arabinosidase	Arabinan endo-1,5-alpha-L-arabinosidase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog HTCS_Ara-1 - Bacteroidaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --