Regulon of HTCS_Ara-1 in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_05305
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Regulog:	HTCS_Ara-1 - Bacteroidaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By effector - Arabinan
By pathway - Arabinan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -268 Score: 7.8 Sequence: TGTCCACCTCAAATGTTCATTTGTCCACCT Locus tag: BACCELL_05304 Name: abn2 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase Locus tag: BACCELL_05303 Name: abf2 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: BACCELL_05302 Name: GH43 Funciton: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
	BACCELL_05304	abn2	Arabinan endo-1,5-alpha-L-arabinosidase
	BACCELL_05303	abf2	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	BACCELL_05302	GH43	Hypothetical glycoside hydrolase, family 43, similar to arabinosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD