Regulon of HTCS_Ara-1 in Bacteroides eggerthii DSM 20697

Properties
Regulator type:	Transcription factor
TF locus tag:	BACEGG_01541
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Regulog:	HTCS_Ara-1 - Bacteroidaceae
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By effector - Arabinan
By pathway - Arabinan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -285 Score: 7.4 Sequence: TGTCCACCTTAAAAGGTCATATATCCACCT Locus tag: BACEGG_01542 Name: abn2 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase Locus tag: BACEGG_01543 Name: abf2 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: BACEGG_01544 Name: GH43 Funciton: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
	BACEGG_01542	abn2	Arabinan endo-1,5-alpha-L-arabinosidase
	BACEGG_01543	abf2	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	BACEGG_01544	GH43	Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
Position: -349 Score: 6.4 Sequence: TCTCTACACTTAAAATTCGTTTATCCACCT Position: -328 Score: 7.3 Sequence: TATCCACCTCTAAAACCCATTTGTCCACCC Locus tag: BACEGG_01540 Name: susC_Ara-3 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BACEGG_01539 Name: susD_Ara-3 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BACEGG_01538 Name: null Funciton: hypothetical protein Locus tag: BACEGG_01537 Name: abn3 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
	BACEGG_01540	susC_Ara-3	TonB-dependent outer membrane transporter of arabinan oligosaccharides
	BACEGG_01539	susD_Ara-3	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
	BACEGG_01538		hypothetical protein
	BACEGG_01537	abn3	Arabinan endo-1,5-alpha-L-arabinosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD