Regulon of HTCS_Ara-1 in Bacteroides plebeius DSM 17135

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPLE_00642
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Regulog:	HTCS_Ara-1 - Bacteroidaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By effector - Arabinan
By pathway - Arabinan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -224 Score: 7.8 Sequence: TATCCACCTATAAAATTCGTTTGTCCACCT Locus tag: BACPLE_00643 Name: susC_Ara-3 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BACPLE_00644 Name: susD_Ara-3 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BACPLE_00645 Name: null Funciton: hypothetical protein Locus tag: BACPLE_00646 Name: abn3 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
	BACPLE_00643	susC_Ara-3	TonB-dependent outer membrane transporter of arabinan oligosaccharides
	BACPLE_00644	susD_Ara-3	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
	BACPLE_00645		hypothetical protein
	BACPLE_00646	abn3	Arabinan endo-1,5-alpha-L-arabinosidase
Position: -153 Score: 6.8 Sequence: TGTCCACCCAATAGAAAAATTTGTCCACCT Locus tag: BACPLE_00641 Name: abf2 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	BACPLE_00641	abf2	Alpha-N-arabinofuranosidase (EC 3.2.1.55)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD