Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing susC_Ara-3 gene

Properties
Regulog: HTCS_Ara-1 - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode: activator
Biological process: Arabinan utilization
Effector: Arabinan
Phylum: Bacteroidetes
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides dorei DSM 17855
Position: -291
Score: 7.50156
Sequence: CGTCCACCCTATAAAACCGTTTGTCCACCC
Locus tag: BACDOR_01719
Name: susC_Ara-3
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BACDOR_01720
Name: susD_Ara-3
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BACDOR_01721
Name: null
Funciton: hypothetical protein
Locus tag: BACDOR_01722
Name: abn3
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BACDOR_01721-abn3 -291 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC BACDOR_01719
Bacteroides eggerthii DSM 20697
Position: -349
Score: 6.41777
Sequence: TCTCTACACTTAAAATTCGTTTATCCACCT
Position: -328
Score: 7.33924
Sequence: TATCCACCTCTAAAACCCATTTGTCCACCC
Locus tag: BACEGG_01540
Name: susC_Ara-3
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BACEGG_01539
Name: susD_Ara-3
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BACEGG_01538
Name: null
Funciton: hypothetical protein
Locus tag: BACEGG_01537
Name: abn3
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BACEGG_01538-abn3 -349 6.4 TCTCTACACTTAAAATTCGTTTATCCACCT BACEGG_01540
-328 7.3 TATCCACCTCTAAAACCCATTTGTCCACCC
Bacteroides plebeius DSM 17135
Position: -224
Score: 7.76473
Sequence: TATCCACCTATAAAATTCGTTTGTCCACCT
Locus tag: BACPLE_00643
Name: susC_Ara-3
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BACPLE_00644
Name: susD_Ara-3
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BACPLE_00645
Name: null
Funciton: hypothetical protein
Locus tag: BACPLE_00646
Name: abn3
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BACPLE_00645-abn3 -224 7.8 TATCCACCTATAAAATTCGTTTGTCCACCT BACPLE_00643
Bacteroides vulgatus ATCC 8482
Position: -265
Score: 7.50156
Sequence: CGTCCACCCTATAAAACCGTTTGTCCACCC
Locus tag: BVU_1005
Name: susC_Ara-3
Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides
Locus tag: BVU_1006
Name: susD_Ara-3
Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides
Locus tag: BVU_1007
Name: null
Funciton: hypothetical protein
Locus tag: BVU_1008
Name: abn3
Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
susC_Ara-3-susD_Ara-3-BVU_1007-abn3 -265 7.5 CGTCCACCCTATAAAACCGTTTGTCCACCC BVU_1005