Regulon of HTCS_Ara-1 in Bacteroides thetaiotaomicron VPI-5482

Properties
Regulator type:	Transcription factor
TF locus tag:	BT0366
Regulator family:	[Other]
Regulation mode:	activator
Biological process:	Arabinan utilization
Effector:	Arabinan
Regulog:	HTCS_Ara-1 - Bacteroidaceae
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By effector - Arabinan
By pathway - Arabinan utilization

Regulated operons
	Locus Tag	Name	Function
Position: -136 Score: 7.6 Sequence: TATCCACCTCGAAAATTCATTTGTCCACCT Locus tag: BT0365 Name: lamG Funciton: Concanavalin A-like lectins/glucanases superfamily Locus tag: BT0364 Name: susC_Ara-1 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BT0363 Name: susD-Ara-1 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BT0362 Name: susC_Ara-2 Funciton: TonB-dependent outer membrane transporter of arabinan oligosaccharides Locus tag: BT0361 Name: susD_Ara-2 Funciton: Outer membrane polysaccharide binding protein for arabinan oligosaccharides Locus tag: BT0360 Name: abn1 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase
	BT0365	lamG	Concanavalin A-like lectins/glucanases superfamily
	BT0364	susC_Ara-1	TonB-dependent outer membrane transporter of arabinan oligosaccharides
	BT0363	susD-Ara-1	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
	BT0362	susC_Ara-2	TonB-dependent outer membrane transporter of arabinan oligosaccharides
	BT0361	susD_Ara-2	Outer membrane polysaccharide binding protein for arabinan oligosaccharides
	BT0360	abn1	Arabinan endo-1,5-alpha-L-arabinosidase
Position: -69 Score: 7 Sequence: TGTCCACCAATCGTGTTCGTATGTCCACCT Locus tag: BT0367 Name: abn2 Funciton: Arabinan endo-1,5-alpha-L-arabinosidase Locus tag: BT0368 Name: abf2 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55) Locus tag: BT0369 Name: GH43 Funciton: Hypothetical glycoside hydrolase, family 43, similar to arabinosidase
	BT0367	abn2	Arabinan endo-1,5-alpha-L-arabinosidase
	BT0368	abf2	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	BT0369	GH43	Hypothetical glycoside hydrolase, family 43, similar to arabinosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD