Regulog XylR - Bacteroidaceae
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacteroidaceae
- By TF family - NrtR
- By effector - Xylose
- By pathway - Xylose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | 5 | 2 |
| Bacteroides coprophilus DSM 18228 | ||
| Bacteroides dorei DSM 17855 | 6 | 4 |
| Bacteroides eggerthii DSM 20697 | 6 | 2 |
| Bacteroides fragilis NCTC 9343 | 4 | 1 |
| Bacteroides ovatus ATCC 8483 | 6 | 2 |
| Bacteroides plebeius DSM 17135 | 4 | 1 |
| Bacteroides stercoris ATCC 43183 | 4 | 2 |
| Bacteroides thetaiotaomicron VPI-5482 | 6 | 2 |
| Bacteroides uniformis ATCC 8492 | 4 | 1 |
| Bacteroides vulgatus ATCC 8482 | 6 | 4 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| xylR |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -119 score = 5.76829 sequence = GATATTGTAAAATGTACGATATC Site: position = -200 score = 5.6437 sequence = CTTATTGTACTTCCTACAATTAC Site: position = -152 score = 5.70014 sequence = CATATTGTACTTTCAACGATAAG Gene: BACCELL_04758: Predicted regulator of xylose utilization, NrtR family |
|
*
Bacteroides dorei DSM 17855 Site: position = -70 score = 4.85895 sequence = CATATTGTATAATAGATGATATT Site: position = -103 score = 5.1313 sequence = TATATTGTAGTGTATATGATAAG Gene: BACDOR_00865: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides eggerthii DSM 20697 Site: position = -208 score = 5.10241 sequence = GTTATTGTGCCTATTACAATTAC Site: position = -161 score = 6.10023 sequence = CATATTGTATTTTGTACGATAAC Site: position = -128 score = 5.42431 sequence = GATATTGTAAAAGATATGATATG Gene: BACEGG_02642: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides fragilis NCTC 9343 Site: position = -280 score = 5.40138 sequence = CATACCCTATAAAATACAATAAG Site: position = -197 score = 5.09863 sequence = CTTTCTGTACTTTCTACAATTAC Site: position = -150 score = 5.66167 sequence = CATATTGTTATCGATACAATAAG Site: position = -117 score = 5.39923 sequence = CTTAGTGTAAAATTTACGATATG Gene: BF2354: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides ovatus ATCC 8483 Site: position = -116 score = 5.4423 sequence = CATATTGTAGAATGTATGATATG Site: position = -149 score = 5.42208 sequence = CATATTGTAATTCGTAAGATAAC Site: position = -195 score = 5.64662 sequence = GTTTTTGTACTTTATACAATTAC Site: position = -279 score = 6.05913 sequence = CATATCGTTTAAAATACAATAAG Gene: BACOVA_02532: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides plebeius DSM 17135 Site: position = -147 score = 5.76348 sequence = CATATTGTATGAACTACAAAAAC Site: position = -114 score = 5.20014 sequence = GATATTGTATCAAATAAGATATT Gene: BACPLE_02263: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides stercoris ATCC 43183 Site: position = -161 score = 6.25464 sequence = CATATTGTATTTTATACGATAAC Site: position = -208 score = 5.50095 sequence = GTTATTGTATCTGCTACAATTAC Site: position = -128 score = 5.83882 sequence = GATATTGTAAGATATACGATATG Gene: BACSTE_01380: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -150 score = 5.07643 sequence = CATATTGTAATTCAGAAGATAAC Site: position = -280 score = 5.88067 sequence = GATATCGTTTGAAATACAATAAG Site: position = -196 score = 5.6939 sequence = CTTTTTGTACTTTATACAATTAC Site: position = -117 score = 5.4423 sequence = CATATTGTAGATTGTATGATATG Gene: BT0791: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides uniformis ATCC 8492 Site: position = -209 score = 5.69098 sequence = CTTATTGTACTTCCTACAATTAG Site: position = -161 score = 5.92556 sequence = CATATTGTATTCCATACGATAAC Site: position = -128 score = 5.65223 sequence = GATATTGTATAAAGTAAGATATG Gene: BACUNI_00695: Predicted regulator of xylose utilization, NrtR family |
*
Bacteroides vulgatus ATCC 8482 Site: position = -136 score = 4.52607 sequence = GATATTGTATGATGGATGATATT Site: position = -169 score = 5.1313 sequence = TATATTGTAGTGTATATGATAAG Gene: BVU_3955: Predicted regulator of xylose utilization, NrtR family |
Predicted regulator of xylose utilization, NrtR family |
| xylB |
Gene: BACCELL_04759: Xylulose kinase (EC 2.7.1.17) |
|
Gene: BACDOR_00866: Xylulose kinase (EC 2.7.1.17) |
Gene: BACEGG_02643: Xylulose kinase (EC 2.7.1.17) |
Gene: BF2355: Xylulose kinase (EC 2.7.1.17) |
Gene: BACOVA_02533: Xylulose kinase (EC 2.7.1.17) |
Gene: BACPLE_02264: Xylulose kinase (EC 2.7.1.17) |
Gene: BACSTE_01381: Xylulose kinase (EC 2.7.1.17) |
Gene: BT0792: Xylulose kinase (EC 2.7.1.17) |
Gene: BACUNI_00694: Xylulose kinase (EC 2.7.1.17) |
Gene: BVU_3954: Xylulose kinase (EC 2.7.1.17) |
Xylulose kinase (EC 2.7.1.17) |
| xylA |
Gene: BACCELL_04760: Xylose isomerase (EC 5.3.1.5) |
|
Gene: BACDOR_00867: Xylose isomerase (EC 5.3.1.5) |
Gene: BACEGG_02644: Xylose isomerase (EC 5.3.1.5) |
Gene: BF2356: Xylose isomerase (EC 5.3.1.5) |
Gene: BACOVA_02534: Xylose isomerase (EC 5.3.1.5) |
Gene: BACPLE_02265: Xylose isomerase (EC 5.3.1.5) |
Gene: BACSTE_01383: Xylose isomerase (EC 5.3.1.5) |
Gene: BT0793: Xylose isomerase (EC 5.3.1.5) |
Gene: BACUNI_00693: Xylose isomerase (EC 5.3.1.5) |
Gene: BVU_3953: Xylose isomerase (EC 5.3.1.5) |
Xylose isomerase (EC 5.3.1.5) |
| xylE |
Gene: BACCELL_04761: D-xylose proton-symporter XylE |
|
*
Bacteroides dorei DSM 17855 Site: position = -41 score = 5.87546 sequence = GTTATTGTATTTATTACGAAAAC Gene: BACDOR_00759: D-xylose proton-symporter XylE |
Gene: BACEGG_02645: D-xylose proton-symporter XylE |
Gene: BF2357: D-xylose proton-symporter XylE |
Gene: BACOVA_02535: D-xylose proton-symporter XylE |
Gene: BACPLE_02266: D-xylose proton-symporter XylE |
Gene: BACSTE_01384: D-xylose proton-symporter XylE |
Gene: BT0794: D-xylose proton-symporter XylE |
Gene: BACUNI_00692: D-xylose proton-symporter XylE |
*
Bacteroides vulgatus ATCC 8482 Site: position = -41 score = 5.87546 sequence = GTTATTGTATTTATTACGAAAAC Gene: BVU_4073: D-xylose proton-symporter XylE |
D-xylose proton-symporter XylE |
| CRON 2. | ||||||||||||
| tkt |
*2
Bacteroides cellulosilyticus DSM 14838 Site: position = -161 score = 5.91062 sequence = CTTATTGTATTTTAAACAAGAAG Gene: BACCELL_05612: Transketolase (EC 2.2.1.1) Gene: BACCELL_05664: Transketolase (EC 2.2.1.1) |
Gene: BACCOPRO_02883: Transketolase (EC 2.2.1.1) |
Gene: BACDOR_03628: Transketolase (EC 2.2.1.1) |
*
Bacteroides eggerthii DSM 20697 Site: position = -166 score = 5.59985 sequence = CTTATTGTAATCAAAACAAGAAG Gene: BACEGG_01528: Transketolase (EC 2.2.1.1) |
Gene: BF1660: Transketolase (EC 2.2.1.1) |
*
Bacteroides ovatus ATCC 8483 Site: position = -128 score = 5.5626 sequence = CTTATTGTATCACAAACAAGAAG Gene: BACOVA_01706: Transketolase (EC 2.2.1.1) |
Gene: BACPLE_02209: Transketolase (EC 2.2.1.1) |
*
Bacteroides stercoris ATCC 43183 Site: position = -161 score = 5.32737 sequence = GTTATTGTATTCAAAACAGGAAG Gene: BACSTE_01846: Transketolase (EC 2.2.1.1) |
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -162 score = 5.32202 sequence = CTTACTGTATTGTAAACAAGAAG Gene: BT0347: Transketolase (EC 2.2.1.1) |
Gene: BACUNI_01365: Transketolase (EC 2.2.1.1) |
Gene: BVU_2318: Transketolase (EC 2.2.1.1) |
Transketolase (EC 2.2.1.1) |
| rpi |
Gene: BACCELL_05665: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACCOPRO_02882: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACDOR_03627: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACEGG_01527: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BF1659: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACOVA_01705: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACPLE_02208: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACSTE_01845: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BT0346: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BACUNI_01366: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Gene: BVU_2317: Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
Ribose 5-phosphate isomerase B (EC 5.3.1.6) |
| CRON 3. | ||||||||||||
| GH3_Xyl |
Gene: BACCELL_01413: Glycoside hydrolase family 3, candidate beta-glycosidase |
|
*
Bacteroides dorei DSM 17855 Site: position = -110 score = 5.57188 sequence = CTTTTCGTACAAAAAACAATATC Gene: BACDOR_01992: Glycoside hydrolase family 3, candidate beta-glycosidase |
Gene: BACEGG_02889: Glycoside hydrolase family 3, candidate beta-glycosidase |
|
|
|
Gene: BACSTE_02707: Glycoside hydrolase family 3, candidate beta-glycosidase |
|
Gene: BACUNI_03534: Glycoside hydrolase family 3, candidate beta-glycosidase |
*
Bacteroides vulgatus ATCC 8482 Site: position = -110 score = 5.85644 sequence = CTTTTTGTATAAAAAACAATATC Gene: BVU_1162: Glycoside hydrolase family 3, candidate beta-glycosidase |
Glycoside hydrolase family 3, candidate beta-glycosidase |
| CRON 4. | ||||||||||||
| SSF48208 |
|
|
*
Bacteroides dorei DSM 17855 Site: position = -91 score = 4.60935 sequence = ATAATTGTTTTTTAGACAATAAA Site: position = -31 score = 5.13246 sequence = ATATTTGTACATTATACAATATC Gene: BACDOR_04539: hypothetical Six-hairpin glycosidase-like |
|
|
|
|
|
|
|
*
Bacteroides vulgatus ATCC 8482 Site: position = -91 score = 4.60935 sequence = ATAATTGTTTTTTAGACAATAAA Site: position = -31 score = 5.13246 sequence = ATATTTGTACATTATACAATATC Gene: BVU_2979: hypothetical Six-hairpin glycosidase-like |
hypothetical Six-hairpin glycosidase-like |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |