Regulon of XylR in Bacteroides plebeius DSM 17135

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPLE_02263
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacteroidaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - NrtR
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -147 Score: 5.8 Sequence: CATATTGTATGAACTACAAAAAC Position: -114 Score: 5.2 Sequence: GATATTGTATCAAATAAGATATT Locus tag: BACPLE_02263 Name: xylR Funciton: Predicted regulator of xylose utilization, NrtR family Locus tag: BACPLE_02264 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: BACPLE_02265 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: BACPLE_02266 Name: xylE Funciton: D-xylose proton-symporter XylE
	BACPLE_02263	xylR	Predicted regulator of xylose utilization, NrtR family
	BACPLE_02264	xylB	Xylulose kinase (EC 2.7.1.17)
	BACPLE_02265	xylA	Xylose isomerase (EC 5.3.1.5)
	BACPLE_02266	xylE	D-xylose proton-symporter XylE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD