Regulon of XylR in Bacteroides fragilis NCTC 9343

Properties
Regulator type:	Transcription factor
TF locus tag:	BF2354
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	Xylose utilization
Effector:	Xylose
Regulog:	XylR - Bacteroidaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 43 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - NrtR
By effector - Xylose
By pathway - Xylose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -280 Score: 5.4 Sequence: CATACCCTATAAAATACAATAAG Position: -197 Score: 5.1 Sequence: CTTTCTGTACTTTCTACAATTAC Position: -150 Score: 5.7 Sequence: CATATTGTTATCGATACAATAAG Position: -117 Score: 5.4 Sequence: CTTAGTGTAAAATTTACGATATG Locus tag: BF2354 Name: xylR Funciton: Predicted regulator of xylose utilization, NrtR family Locus tag: BF2355 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: BF2356 Name: xylA Funciton: Xylose isomerase (EC 5.3.1.5) Locus tag: BF2357 Name: xylE Funciton: D-xylose proton-symporter XylE
	BF2354	xylR	Predicted regulator of xylose utilization, NrtR family
	BF2355	xylB	Xylulose kinase (EC 2.7.1.17)
	BF2356	xylA	Xylose isomerase (EC 5.3.1.5)
	BF2357	xylE	D-xylose proton-symporter XylE

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD