Statistics of regulated genes

Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R	3	2
Streptococcus dysgalactiae subsp. equisimilis GGS_124	3	1
Streptococcus equi subsp. zooepidemicus MGCS10565	1	1
Streptococcus gallolyticus UCN34	3	1
Streptococcus gordonii str. Challis substr. CH1	3	1
Streptococcus mitis B6	3	1
Streptococcus mutans UA159	3	1
Streptococcus pneumoniae TIGR4	3	1
Streptococcus pyogenes M1 GAS	3	1
Streptococcus sanguinis SK36	3	1
Streptococcus suis 05ZYH33	4	1
Streptococcus thermophilus CNRZ1066	3	1
Streptococcus uberis 0140J	5	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
yjdR	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	* Streptococcus agalactiae 2603V/R Site: position = -35 score = 6.38723 sequence = ATAGTTCTCACGGTAACTAT Gene: SAG1332: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -55 score = 6.37238 sequence = ATAGTTATCCAGAGAACTAA Gene: SDEG_1978: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -52 score = 6.26046 sequence = ATAGTTCCCAAGAGAACTAA Site: position = -31 score = 6.07592 sequence = ATGGTTATCATGAGAACTAA Gene: Sez_0219: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus gallolyticus UCN34 Site: position = -71 score = 6.68152 sequence = ATAGTTCTCATAAGAACTAT Gene: GALLO_1290: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus gordonii str. Challis substr. CH1 Site: position = -37 score = 5.90313 sequence = TTTGTTCTCAAGAGAACTAA Site: position = -57 score = 6.13512 sequence = ATAGTTCTCACGGTAACTTA Gene: SGO_1752: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus mitis B6 Site: position = -117 score = 5.96433 sequence = ATAGTTCTCTAGGAAACTTT Site: position = -66 score = 6.2145 sequence = ATAGTTCTCATGGAAACTTA Gene: smi_1836: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus mutans UA159 Site: position = -52 score = 6.53336 sequence = ATAGTTTTCATGAGAACTAT Gene: SMU.921: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus pneumoniae TIGR4 Site: position = -42 score = 5.89221 sequence = ATTATTCTCCAGAGAACTAT Gene: SP_1920: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus pyogenes M1 GAS Site: position = -282 score = 6.37238 sequence = ATAGTTATCTAGAGAACTAA Gene: SPy0228: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus sanguinis SK36 Site: position = -89 score = 6.2145 sequence = ATAGTTCTCATGGAAACTTT Site: position = -39 score = 6.56276 sequence = ATAGTTCTCACGAAAACTAT Gene: SSA_0460: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus suis 05ZYH33 Site: position = -40 score = 5.90529 sequence = ATAGTTCTCATGGTAATTAT Site: position = -61 score = 6.56967 sequence = ATAGTTCTTAAGAGAACTAT Gene: SSU05_2039: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus thermophilus CNRZ1066 Site: position = -58 score = 6.42941 sequence = ATAGTTCTTATAAGAACTAA Gene: str0432: Predicted multidrug resistance transcriptional regulator, MarR family	* Streptococcus uberis 0140J Site: position = -51 score = 6.46661 sequence = ATAGTTCTCTTAAGAACTAA Site: position = -30 score = 5.90734 sequence = ATGGTTTTCACGAGAACTAA Gene: SUB1690: Predicted multidrug resistance transcriptional regulator, MarR family	Predicted multidrug resistance transcriptional regulator, MarR family
ydaG	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0346: Predicted ABC multidrug transporter, ATP-binding and permease protein	Lactococcus lactis subsp. lactis Il1403 Gene: L109162: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1977: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0220: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0165: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mitis B6 Gene: smi_0153: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4 Gene: SP_2075: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus pyogenes M1 GAS Gene: SPy0229: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus sanguinis SK36 Gene: SSA_2167: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus suis 05ZYH33 Gene: SSU05_2038: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB1689: Predicted ABC multidrug transporter, ATP-binding and permease protein	Predicted ABC multidrug transporter, ATP-binding and permease protein
ydbA	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_0347: Predicted ABC multidrug transporter, ATP-binding and permease protein	Lactococcus lactis subsp. lactis Il1403 Gene: L110899: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124 Gene: SDEG_1976: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_0221: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_0166: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mitis B6 Gene: smi_0154: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4 Gene: SP_2073: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus pyogenes M1 GAS Gene: SPy0230: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus sanguinis SK36 Gene: SSA_2166: Predicted ABC multidrug transporter, ATP-binding and permease protein	2 Streptococcus suis 05ZYH33 Gene: SSU05_2036: Predicted ABC multidrug transporter, ATP-binding and permease protein Gene: SSU05_2037: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB1688: Predicted ABC multidrug transporter, ATP-binding and permease protein	Predicted ABC multidrug transporter, ATP-binding and permease protein
yfiB	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1289: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1751: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mitis B6 Gene: smi_1835: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mutans UA159 Gene: SMU.922: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus pneumoniae TIGR4 Gene: SP_1919: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_0461: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str0433: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus uberis 0140J	Predicted ABC multidrug transporter, ATP-binding and permease protein
yfiC	Lactococcus lactis subsp. cremoris SK11	Lactococcus lactis subsp. lactis Il1403	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_1288: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus gordonii str. Challis substr. CH1 Gene: SGO_1750: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mitis B6 Gene: smi_1834: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus mutans UA159 Gene: SMU.923: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus pneumoniae TIGR4 Gene: SP_1918: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36 Gene: SSA_0462: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066 Gene: str0434: Predicted ABC multidrug transporter, ATP-binding and permease protein	Streptococcus uberis 0140J	Predicted ABC multidrug transporter, ATP-binding and permease protein
CRON 2.
yjdE	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1383: Predicted drug resistance transporter, EmrB/QacA family	Lactococcus lactis subsp. lactis Il1403 Gene: L132251: Predicted drug resistance transporter, EmrB/QacA family	* Streptococcus agalactiae 2603V/R Site: position = -144 score = 6.56276 sequence = ATAGTTCTCACGATAACTAA Gene: SAG1707: Predicted drug resistance transporter, EmrB/QacA family	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565 Gene: Sez_1345: Predicted drug resistance transporter, EmrB/QacA family	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	* Streptococcus uberis 0140J Site: position = -87 score = 6.04976 sequence = ATAGTTCTCAGGGTAACTAT Gene: SUB1642: Predicted drug resistance transporter, EmrB/QacA family	Predicted drug resistance transporter, EmrB/QacA family
yjdF	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_1382: Conserved hypothetical protein	Lactococcus lactis subsp. lactis Il1403 Gene: L133825: Conserved hypothetical protein	Streptococcus agalactiae 2603V/R Gene: SAG1706: Conserved hypothetical protein	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J Gene: SUB1643: Conserved hypothetical protein	Conserved hypothetical protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD