Regulog YjdR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | MarR |
| Regulation mode: | |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - MarR
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | 3 | 2 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 3 | 1 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | 1 | 1 |
| Streptococcus gallolyticus UCN34 | 3 | 1 |
| Streptococcus gordonii str. Challis substr. CH1 | 3 | 1 |
| Streptococcus mitis B6 | 3 | 1 |
| Streptococcus mutans UA159 | 3 | 1 |
| Streptococcus pneumoniae TIGR4 | 3 | 1 |
| Streptococcus pyogenes M1 GAS | 3 | 1 |
| Streptococcus sanguinis SK36 | 3 | 1 |
| Streptococcus suis 05ZYH33 | 4 | 1 |
| Streptococcus thermophilus CNRZ1066 | 3 | 1 |
| Streptococcus uberis 0140J | 5 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| yjdR |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -35 score = 6.38723 sequence = ATAGTTCTCACGGTAACTAT Gene: SAG1332: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -55 score = 6.37238 sequence = ATAGTTATCCAGAGAACTAA Gene: SDEG_1978: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus equi subsp. zooepidemicus MGCS10565 Site: position = -52 score = 6.26046 sequence = ATAGTTCCCAAGAGAACTAA Site: position = -31 score = 6.07592 sequence = ATGGTTATCATGAGAACTAA Gene: Sez_0219: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus gallolyticus UCN34 Site: position = -71 score = 6.68152 sequence = ATAGTTCTCATAAGAACTAT Gene: GALLO_1290: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -37 score = 5.90313 sequence = TTTGTTCTCAAGAGAACTAA Site: position = -57 score = 6.13512 sequence = ATAGTTCTCACGGTAACTTA Gene: SGO_1752: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus mitis B6 Site: position = -117 score = 5.96433 sequence = ATAGTTCTCTAGGAAACTTT Site: position = -66 score = 6.2145 sequence = ATAGTTCTCATGGAAACTTA Gene: smi_1836: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus mutans UA159 Site: position = -52 score = 6.53336 sequence = ATAGTTTTCATGAGAACTAT Gene: SMU.921: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus pneumoniae TIGR4 Site: position = -42 score = 5.89221 sequence = ATTATTCTCCAGAGAACTAT Gene: SP_1920: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus pyogenes M1 GAS Site: position = -282 score = 6.37238 sequence = ATAGTTATCTAGAGAACTAA Gene: SPy0228: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus sanguinis SK36 Site: position = -89 score = 6.2145 sequence = ATAGTTCTCATGGAAACTTT Site: position = -39 score = 6.56276 sequence = ATAGTTCTCACGAAAACTAT Gene: SSA_0460: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus suis 05ZYH33 Site: position = -40 score = 5.90529 sequence = ATAGTTCTCATGGTAATTAT Site: position = -61 score = 6.56967 sequence = ATAGTTCTTAAGAGAACTAT Gene: SSU05_2039: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus thermophilus CNRZ1066 Site: position = -58 score = 6.42941 sequence = ATAGTTCTTATAAGAACTAA Gene: str0432: Predicted multidrug resistance transcriptional regulator, MarR family |
*
Streptococcus uberis 0140J Site: position = -51 score = 6.46661 sequence = ATAGTTCTCTTAAGAACTAA Site: position = -30 score = 5.90734 sequence = ATGGTTTTCACGAGAACTAA Gene: SUB1690: Predicted multidrug resistance transcriptional regulator, MarR family |
Predicted multidrug resistance transcriptional regulator, MarR family |
| ydaG |
Gene: LACR_0346: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: L109162: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SDEG_1977: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: Sez_0220: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SGO_0165: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: smi_0153: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SP_2075: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SPy0229: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SSA_2167: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SSU05_2038: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SUB1689: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Predicted ABC multidrug transporter, ATP-binding and permease protein |
| ydbA |
Gene: LACR_0347: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: L110899: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SDEG_1976: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: Sez_0221: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SGO_0166: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: smi_0154: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SP_2073: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SPy0230: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SSA_2166: Predicted ABC multidrug transporter, ATP-binding and permease protein |
2
Streptococcus suis 05ZYH33 Gene: SSU05_2036: Predicted ABC multidrug transporter, ATP-binding and permease protein Gene: SSU05_2037: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SUB1688: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Predicted ABC multidrug transporter, ATP-binding and permease protein |
| yfiB |
|
|
|
|
|
Gene: GALLO_1289: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SGO_1751: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: smi_1835: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SMU.922: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SP_1919: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SSA_0461: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: str0433: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Predicted ABC multidrug transporter, ATP-binding and permease protein |
| yfiC |
|
|
|
|
|
Gene: GALLO_1288: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SGO_1750: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: smi_1834: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SMU.923: Predicted ABC multidrug transporter, ATP-binding and permease protein |
Gene: SP_1918: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: SSA_0462: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Gene: str0434: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|
Predicted ABC multidrug transporter, ATP-binding and permease protein |
| CRON 2. | ||||||||||||||||
| yjdE |
Gene: LACR_1383: Predicted drug resistance transporter, EmrB/QacA family |
Gene: L132251: Predicted drug resistance transporter, EmrB/QacA family |
*
Streptococcus agalactiae 2603V/R Site: position = -144 score = 6.56276 sequence = ATAGTTCTCACGATAACTAA Gene: SAG1707: Predicted drug resistance transporter, EmrB/QacA family |
|
Gene: Sez_1345: Predicted drug resistance transporter, EmrB/QacA family |
|
|
|
|
|
|
|
|
|
*
Streptococcus uberis 0140J Site: position = -87 score = 6.04976 sequence = ATAGTTCTCAGGGTAACTAT Gene: SUB1642: Predicted drug resistance transporter, EmrB/QacA family |
Predicted drug resistance transporter, EmrB/QacA family |
| yjdF |
Gene: LACR_1382: Conserved hypothetical protein |
Gene: L133825: Conserved hypothetical protein |
Gene: SAG1706: Conserved hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
Gene: SUB1643: Conserved hypothetical protein |
Conserved hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |