Regulon of YjdR in Streptococcus uberis 0140J

Properties
Regulator type:	Transcription factor
TF locus tag:	SUB1690
Regulator family:	MarR
Regulation mode:
Biological process:	Multidrug resistance
Effector:
Regulog:	YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - MarR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.5 Sequence: ATAGTTCTCTTAAGAACTAA Position: -30 Score: 5.9 Sequence: ATGGTTTTCACGAGAACTAA Locus tag: SUB1690 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SUB1689 Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SUB1688 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
	SUB1690	yjdR	Predicted multidrug resistance transcriptional regulator, MarR family
	SUB1689	ydaG	Predicted ABC multidrug transporter, ATP-binding and permease protein
	SUB1688	ydbA	Predicted ABC multidrug transporter, ATP-binding and permease protein
Position: -87 Score: 6 Sequence: ATAGTTCTCAGGGTAACTAT Locus tag: SUB1642 Name: yjdE Funciton: Predicted drug resistance transporter, EmrB/QacA family Locus tag: SUB1643 Name: yjdF Funciton: Conserved hypothetical protein
	SUB1642	yjdE	Predicted drug resistance transporter, EmrB/QacA family
	SUB1643	yjdF	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD