Regulon of YjdR in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1332
Regulator family:	MarR
Regulation mode:
Biological process:	Multidrug resistance
Effector:
Regulog:	YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - MarR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6.4 Sequence: ATAGTTCTCACGGTAACTAT Locus tag: SAG1332 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
	SAG1332	yjdR	Predicted multidrug resistance transcriptional regulator, MarR family
Position: -144 Score: 6.6 Sequence: ATAGTTCTCACGATAACTAA Locus tag: SAG1707 Name: yjdE Funciton: Predicted drug resistance transporter, EmrB/QacA family Locus tag: SAG1706 Name: yjdF Funciton: Conserved hypothetical protein
	SAG1707	yjdE	Predicted drug resistance transporter, EmrB/QacA family
	SAG1706	yjdF	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD