Regulon of YjdR in Streptococcus pneumoniae TIGR4

Properties
Regulator type:	Transcription factor
TF locus tag:	SP_1920
Regulator family:	MarR
Regulation mode:
Biological process:	Multidrug resistance
Effector:
Regulog:	YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - MarR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 5.9 Sequence: ATTATTCTCCAGAGAACTAT Locus tag: SP_1920 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SP_1919 Name: yfiB Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SP_1918 Name: yfiC Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
	SP_1920	yjdR	Predicted multidrug resistance transcriptional regulator, MarR family
	SP_1919	yfiB	Predicted ABC multidrug transporter, ATP-binding and permease protein
	SP_1918	yfiC	Predicted ABC multidrug transporter, ATP-binding and permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD