Regulon of YjdR in Streptococcus gallolyticus UCN34
| Regulator type: | Transcription factor |
| TF locus tag: | GALLO_1290 |
| Regulator family: | MarR |
| Regulation mode: | |
| Biological process: | Multidrug resistance |
| Effector: | |
| Regulog: | YjdR - Streptococcaceae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - MarR
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -71
Score: 6.7 Sequence: ATAGTTCTCATAAGAACTAT
Locus tag: GALLO_1290
Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family
Locus tag: GALLO_1289
Name: yfiB Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
Locus tag: GALLO_1288
Name: yfiC Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein |
|||
|
yjdR
|
Predicted multidrug resistance transcriptional regulator, MarR family
|
||
|
yfiB
|
Predicted ABC multidrug transporter, ATP-binding and permease protein
|
||
|
yfiC
|
Predicted ABC multidrug transporter, ATP-binding and permease protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |