Regulon of YjdR in Streptococcus suis 05ZYH33

Properties
Regulator type:	Transcription factor
TF locus tag:	SSU05_2039
Regulator family:	MarR
Regulation mode:
Biological process:	Multidrug resistance
Effector:
Regulog:	YjdR - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - MarR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.6 Sequence: ATAGTTCTTAAGAGAACTAT Position: -40 Score: 5.9 Sequence: ATAGTTCTCATGGTAATTAT Locus tag: SSU05_2039 Name: yjdR Funciton: Predicted multidrug resistance transcriptional regulator, MarR family Locus tag: SSU05_2038 Name: ydaG Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SSU05_2037 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein Locus tag: SSU05_2036 Name: ydbA Funciton: Predicted ABC multidrug transporter, ATP-binding and permease protein
	SSU05_2039	yjdR	Predicted multidrug resistance transcriptional regulator, MarR family
	SSU05_2038	ydaG	Predicted ABC multidrug transporter, ATP-binding and permease protein
	SSU05_2037	ydbA	Predicted ABC multidrug transporter, ATP-binding and permease protein
	SSU05_2036	ydbA	Predicted ABC multidrug transporter, ATP-binding and permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD