Regulog XylR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By trascription factor - XylR
- By TF family - ROK
- By effector - Xylose
- By pathway - Xylose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 11 | 6 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 5 | 3 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | 3 | 2 |
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 5 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| LVIS_2287 |
|
*
Lactobacillus brevis ATCC 367 Site: position = -90 score = 5.12814 sequence = GTTGGTTGCTTTCGACAACTAAT Gene: LVIS_2287: AraC-type DNA-binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
AraC-type DNA-binding protein |
| xynT2 |
|
Gene: LVIS_2286: Xyloside transporter XynT |
|
|
|
|
|
|
|
|
|
|
|
|
|
Xyloside transporter XynT |
| xynB |
|
Gene: LVIS_2285: Beta-xylosidase |
|
|
|
|
|
|
|
|
|
|
|
|
|
Beta-xylosidase |
| CRON 2. | ||||||||||||||||
| xynB2 |
|
Gene: LVIS_0375: Beta-xylosidase (EC 3.2.1.37) |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -121 score = 5.4642 sequence = GTTTGTTTACTAAATAAACTAAC Gene: LAF_0405: Beta-xylosidase (EC 3.2.1.37) |
|
|
|
|
|
|
|
Gene: LEUM_0848: Beta-xylosidase (EC 3.2.1.37) |
|
|
Beta-xylosidase (EC 3.2.1.37) |
| xynT3 |
|
Gene: LVIS_0374: Xyloside transporter XynT |
|
|
Gene: LAF_0406: Xyloside transporter XynT |
|
|
|
|
|
|
|
|
|
|
Xyloside transporter XynT |
| CRON 3. | ||||||||||||||||
| xylS |
|
*
Lactobacillus brevis ATCC 367 Site: position = -150 score = 5.26024 sequence = GTTGGTTTAGTAAACCAATTTAC Gene: LVIS_0462: Alpha-xylosidase (EC 3.2.1.-) |
|
|
|
|
|
|
|
|
|
|
Gene: LEUM_1244: Alpha-xylosidase (EC 3.2.1.-) |
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -182 score = 5.12047 sequence = GTTTGTTAGTTCTATTTACAAAC Gene: PEPE_0184: Alpha-xylosidase (EC 3.2.1.-) |
Alpha-xylosidase (EC 3.2.1.-) |
| CRON 4. | ||||||||||||||||
| xynT |
|
*
Lactobacillus brevis ATCC 367 Site: position = -151 score = 5.26024 sequence = GTAAATTGGTTTACTAAACCAAC Gene: LVIS_0463: Xyloside transporter XynT |
|
|
|
|
|
|
|
|
|
|
Gene: LEUM_1245: Xyloside transporter XynT |
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -66 score = 5.12047 sequence = GTTTGTAAATAGAACTAACAAAC Gene: PEPE_0185: Xyloside transporter XynT |
Xyloside transporter XynT |
| xylR |
|
*2
Lactobacillus brevis ATCC 367 Site: position = -154 score = 5.43649 sequence = GTTGGTTGGTTCACTGAACCATG Gene: LVIS_2109: Xylose repressor XylR, ROK family Gene: LVIS_0464: Xylose repressor XylR, ROK family |
|
|
Gene: LAF_0400: Xylose repressor XylR, ROK family |
|
|
|
|
|
|
|
Gene: LEUM_0129: Xylose repressor XylR, ROK family |
|
Gene: PEPE_0186: Xylose repressor XylR, ROK family |
Xylose repressor XylR, ROK family |
| xylA |
|
*
Lactobacillus brevis ATCC 367 Site: position = -42 score = 5.71647 sequence = GTTGGTTGTCGCAACGAACTAAC Gene: LVIS_0183: Xylose isomerase (EC 5.3.1.5) |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -53 score = 5.05479 sequence = GTTAGTTGTTTTAAAAAACCAAT Gene: LAF_0402: Xylose isomerase (EC 5.3.1.5) |
|
|
|
|
|
|
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -59 score = 5.79516 sequence = GTTGGTTGGTGTAACCAACTATG Gene: LEUM_0130: Xylose isomerase (EC 5.3.1.5) |
|
Gene: PEPE_0187: Xylose isomerase (EC 5.3.1.5) |
Xylose isomerase (EC 5.3.1.5) |
| xylB |
|
Gene: LVIS_0184: Xylulose kinase (EC 2.7.1.17) |
|
|
Gene: LAF_0403: Xylulose kinase (EC 2.7.1.17) |
|
|
|
|
|
|
|
Gene: LEUM_0131: Xylulose kinase (EC 2.7.1.17) |
|
Gene: PEPE_0188: Xylulose kinase (EC 2.7.1.17) |
Xylulose kinase (EC 2.7.1.17) |
| CRON 5. | ||||||||||||||||
| LVIS_0185 |
|
*
Lactobacillus brevis ATCC 367 Site: position = -111 score = 5.42824 sequence = CATGGTTGGTTGCGGCAATCAAC Site: position = -107 score = 6.08539 sequence = GTTGGTTGCGGCAATCAACCAAC Gene: LVIS_0185: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| xylT |
|
Gene: LVIS_0186: D-xylose proton-symporter XylT |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -90 score = 5.23473 sequence = GTTAGTTTTTATCAGCAACTAAC Gene: LAF_0401: D-xylose proton-symporter XylT |
|
|
|
|
|
|
|
*
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 Site: position = -87 score = 5.64869 sequence = GTTAGTTGGTTGCGTAAATAAAC Site: position = -83 score = 5.68123 sequence = GTTGGTTGCGTAAATAAACTAAC Gene: LEUM_0128: D-xylose proton-symporter XylT |
|
|
D-xylose proton-symporter XylT |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |